FUNCTIONS OF ORGANELLE-SPECIFIC NUCLEIC ACID
BINDING PROTEIN FAMILIES IN CHLOROPLAST
GENE EXPRESSION
by
JANA PRIKRYL
A DISSERTATION
Presented to the Department of Biology
and the Graduate School of the University of Oregon
in partial fulfillment of the requirements
for the degree of
Doctor of Philosophy
December 2009
11
University of Oregon Graduate School
Confirmation of Approval and Acceptance of Dissertation prepared by:
Jana Prikryl
Title:
"Functions of Organelle-Specific Nucleic Acid Binding Protein Families in Chloroplast Gene
Expression"
This dissertation has been accepted and approved in partial fulfillment of the requirements for
the Doctor of Philosophy degree in the Department of Biology by:
Eric Selker, Chairperson, Biology
Alice Barkan, Advisor, Biology
Victoria Herman, Member, Biology
Karen Guillemin, Member, Biology
J. Andrew Berglund, Outside Member, Chemistry
and Richard Linton, Vice President for Research and Graduate Studies/Dean of the Graduate
School for the University of Oregon.
December 12, 2009
Original approval signatures are on file with the Graduate School and the University of Oregon
Libraries.
111
An Abstract of the Dissertation of
Jana Prikryl for the degree of
in the Department ofBiology to be taken
Doctor ofPhilosophy
December 2009
Title: FUNCTIONS OF ORGANELLE-SPECIFIC NUCLEIC ACID BINDING
PROTEIN FAMILIES IN CHLOROPLAST GENE EXPRESSION
Approved: _
Dr. Alice Barkan
My dissertation research has centered on understanding how nuclear encoded
proteins affect chloroplast gene expression in higher plants. I investigated the functions
of three proteins that belong to families whose members function solely or primarily in
mitochondrial and chloroplast gene expression; the Whirly family (ZmWHYI) and the
pentatricopeptide repeat (PPR) family (ZmPPR5 and ZmPPRl0). The Whirly family is
a plant specific protein family whose members have been described as nuclear DNA-
binding proteins involved in transcription and telomere maintenance. I have shown that
ZmWHYl is localized to the chloroplast where it binds nonspecifically to DNA and
also binds specifically to the atpF group II intron RNA. Why] mutants show reduced
atpF intron splicing suggesting that WHYl is directly involved in atpF RNA
maturation. Why] mutants also have aberrant 23S rRNA metabolism resulting in a lack
of plastid ribosomes. The PPR protein family is found in all eukaryotes but is greatly
expanded in land plants. Most PPR proteins are predicted to localize to the
mitochondria or chloroplasts where they are involved in many RNA-related processes
including splicing, cleavage, editing, stabilization and translational control. Our results
IV
with PPR5 and PPR10 suggest that most of these activities may result directly from the
unusually long RNA binding surface predicted for PPR proteins, which we have shown
imparts two biochemical properties: site-specific protection of RNA from other proteins
and site-specific RNA unfolding activity. I narrowed down the binding site for PPR5
and PPR10 to ~45 nt and 19 nt, respectively. I showed that PPR5 contributes to the
splicing of its group II intron ligand by restructuring sequences that are important for
splicing. I used in vitro assays with purified PPR10 to confirm that PPR1 0 can block
exonucleolytic RNA decay from both the 5' and 3' directions, as predicted by prior in
vivo data. I also present evidence that PPR1 0 promotes translation by restructuring its
RNA ligand to allow access to the ribosome. These findings illustrate how the unusually
long RNA interaction surface predicted for PPR proteins can have diverse effects on
RNA metabolism.
This dissertation includes both previously published and unpublished co-
authored material.
CURRICULUM VITAE
NAME OF AUTHOR: Jana Prikryl
PLACE OF BIRTH: Olomouc, Czech Republic
DATE OF BIRTH: March 30,1976
GRADUATE AND UNDERGRADUATE SCHOOLS ATTENDED:
University of Oregon, Eugene
University of Colorado, Boulder
University of Colorado, Colorado Springs
Pikes Peak Community College, Colorado Springs
DEGREES AWARDED:
Doctor of Philosophy, Department of Biology, 2009, University of Oregon
Bachelor of Arts, 1998, University of Colorado, Boulder
AREAS OF SPECIAL INTEREST:
Molecular and Cellular Biology
Genetics
Biochemistry
PROFESSIONAL EXPERIENCE:
Graduate Teaching Fellow, Department of Biology, University of Oregon,
Eugene, 2004-2005 and 2008-2009
v
vi
Teaching Assistant, Department of Molecular, Cellular, and Developmental
Biology, University of Colorado, Boulder, 2002-2004
Professional research assistant, lab of Professor Kathleen Danna, University of
Colorado, Boulder, 1998-2001
Professional research assistant, lab of Professor Peter Kuempel, University of
Colorado, Boulder, 1998-2000
GRANTS, AWARDS AND HONORS:
American Association for the Advancement of Science (AAAS)/ Program for
Excellence in Science, 2008-2009
Genetics training grant, National Institute ofHealth (NIH), 2004-2006 and 2008
Molecular Biology training grant, National Institute of Health (NIH), 2006-2007
Co-president of Students in Biological Sciences (SIBS) graduate student group,
2006-2007
Undergraduate Research Opportunities (UROP) Grant, University of Colorado,
1998
PUBLICATIONS:
pfalz J, Ali Bayraktar 0, Prikryl J, and Barkan A. (2009) Site-specific binding
of a PPR protein defines and stabilizes 5' and 3' mRNA termini in chloroplasts.
EMBO J 28(14):2042-52.
Prikryl J, Watkins KP, Friso G, van Wijk KJ, Barkan A. (2008) A member of
the Whirly family is a multifunctional RNA- and DNA-binding protein that is
essential for chloroplast biogenesis. Nucleic Acids Res 36(16):5152-65.
Prikryl J, Hendricks EC, Kuempel PL. (2001) DNA degradation in the terminus
region of resolvase mutants of Escherichia coli, and suppression of this
degradation and the Difphenotype by reeD. Biochimie 83(2):171-6.
Vll
ACKNOWLEDGMENTS
I am sincerely grateful to my advisor Alice Barkan for her encouragement,
support and thoughtfulness. She has gone far beyond the call of duty to help me progress
as a scientist. Sincere and conscientious, she is not only a wonderful mentor but also, a
model of what I believe a scientist, collaborator, and educator should be. I am extremely
thankful for my lab mates Kenneth Watkins, Tiffany Kroeger, Margarita Rojas, Rosalind
Williams-Carrier, Susan Belcher, Yukari Asakura, and Jeannette Pfalz. They are
invaluable to me as both coworkers and as friends. They have always made time to give
me helpful advice and share their vast knowledge. They have supported me through
failure and success. They have forgiven me for being irritable at times. Their camaraderie
and passion for their work is uplifting and inspiring.
I am very appreciative to the members of my committee Eric Selker, Tory
Herman, Karen Guillemin, and Andy Berglund. Their helpful advice and involvement in
the progress of my graduate career have truly made a positive impact. I am thankful to the
staff of the Institute of Molecular Biology and the Biology Department, they have made
my life easier in so many ways I cannot list them all here. I am ever grateful for my
friends Kohl, Bob, Tiffany, Luke, Emily, Scott, Clair, and Andy for their companionship
and support, and to my parents Jarmila and Ivan and my sister Helena who are the model
of courage, and love, and who give me strength to move forward.
Vlll
DEDICATION
This dissertation is dedicated to Professor Nancy Guild whose kind nature, devotion to
teaching, and classroom ingenuity continue to inspire me, and whose encouragement
and support gave me the confidence to set out on this path.
ix
TABLE OF CONTENTS
Chapter Page
I. INTRODUCTION 1
Co-Evolution of the Chloroplast and Nuclear Genomes 1
RNA Metabolism in the Chloroplast 2
Non-Canonical RNA Binding Proteins in the Organelles 3
II. A :MEMBER OF THE WHIRLY FAMILY IS A MULTIFUNCTIONAL
RNA AND DNA BINDING PROTEIN THAT IS ESSENTIAL FOR
CHLOROPLAST BIOGENESIS 5
Introduction 5
Materials and Methods 7
Purification of CRS 1 Ribonucleoproteins and Mass Spectrometry 7
Plant Material 7
Generation ofRecombinant ZmWHY1 for Antibody Production and
Binding Assays................................................................................. 7
Chloroplast Fractionation and Protein Analysis 8
Nucleic Acid Coimmunoprecipitation Assays 8
Analysis of DNA and RNA 9
Nucleic Acid Binding Assays 9
Chloroplast Run-On Transcription Assay 10
Results 10
Identification of ZmWHY1 in CRS 1 Coimmunoprecipitates 10
Recovery of ZmWhyl Insertion Mutants 11
ZmWHY1 Partitions Between the Chloroplast Stroma and Thylakoid
Membrane, To Which it is Bound in a DNA-Dependent Manner ...... 14
ZmWHYI Is Associated With Large RNA- and DNA-Containing
Particles............................................................................................ 14
xChapter Page
Coimmunoprecipitation Assays Demonstrate That ZmWHY1
Associates with a Subset ofPlastid RNAs That Includes the atpF
Intron 17
DNA From Throughout the Plastid Genome Coimmunoprecipitates
with ZmWHYI 20
Zm Why1 Mutants Are Deficient for Plastid Ribosomes 21
ZmWHY1 Promotes atpF Intron Splicing 25
ZmWHYI Is Required Neither for Chloroplast DNA Replication nor
for Global Plastid Transcription........................................................ 27
Recombinant ZmWHY1 Binds Single-Stranded RNA and DNA in
Vitro 30
Discussion 32
Multiple Roles of ZmWHYI in Chloroplast Biogenesis 32
ZmWHY1 Binds both RNA and DNA in Vitro and in Vivo 33
What is WHY1's DNA-Related Function in the Chloroplast? 34
Bridge 36
III. BIOCHEMICAL ANALYSES SUGGEST THAT PPRIRNA
INTERACTIONS INVOLVE AN UNUSUAL RNA/PROTEIN
INTERFACE THAT IS SUFFICIENT TO MEDIATE A VARIETY OF
POSTTRANSCRIPTIONAL EFFECTS ;......... 37
Introduction 37
Materials and Methods 39
Ribonucleic Acid Binding Assays 39
Minimal Binding Assay Using Partially Alkali Hydrolyzed RNA 40
PNPase Purification.............................................................................. 40
In Vitro Exonuclease Protection Assays................................................ 41
Nuclease Cleavage Structure Probing Assays 42
2-Aminopurine Fluorescence Assay 43
Results 43
The Minimal PPRI0 Binding Site Spans 15 Nucleotides 43
PPRI0 Protects its RNA Ligand From 3' and 5' Exonucleolytic
Cleavage in Vitro 44
Xl
Chapter Page
PPR10 Binding Releases the atpH Ribosome Binding Site From a
Sequestering Secondary Structure........................... 49
The PPR5 Binding Site is Complex and Includes Discontinuous RNA
Segments 51
PPR5-Induced Changes in RNA Structure Suggest Mechanisms by
which PPR5 Enhances Splicing 56
Discussion 62
Features of the PPRlO Binding Site Suggest That PPRlO Binds RNA
Along an Unusually Long RNAIProtein Interface 62
Site-Specific Barrier and RNA Remodeling Functions of PPR5 and
PPRlO: Implications for the Mechanisms by which PPR Proteins
Mediate Downstream Effects 65
IV. CONCLUSIONS AND FUTURE DIRECTIONS 69
Conclusions 69
Future Directions 72
Future Directions Related to WHY1 72
Immediate Directions Related to PPR Proteins 72
Long-Term Directions Related to PPR Proteins 73
REFERENCES 76
xii
LIST OF FIGURES
Figure Page
CHAPTER II
1. Mutant Alleles ofZmWhyl 12
2. Intracellular Localization ofZmWHYI 15
3. Sucrose-gradient sedimentation demonstrating that ZmWHY1 is
associated with DNA- and RNA-containing particles in chloroplast
stroma 16
4. Identification of chloroplast RNAs and DNAs that coimmunoprecipitate
with ZmWHY1 18
5. Plastid ribosome deficiency in ZmWhyl mutants 22
6. Reduced atpF intron splicing in ZmWhyl mutants 26
7. Accumulation of plastid RNAs in ZmWhyl mutants 28
8. Chloroplast DNA levels in ZmWhyl mutants 29
9. Recombinant ZmWHY1 binds single-stranded RNA and DNA 31
CHAPTER III
1. The PPRI0 RNA ligand 45
2. Stoichiometric binding assay with recombinant PPRIO 47
3. PPRI0 protects against 3' and 5' exonuclease activity in vitro 48
4. PPRI0 binding induces structural changes in the atpH 5'UTR 50
5. Mapping the boundaries of sequences required for a high-affinity
interaction with PPR5 53
6. The PPR5 RNA ligand 55
7. Ribonuclease sensitivity assay of RNA structure in the absence and
presence ofPPR5 58
8. PPR5 causes an increase in 2-aminopurine fluorescence in its ligand,
indicating unfolding of the RNA stem 61
1CHAPTER I
INTRODUCTION
Co-Evolution of the Chloroplast and Nuclear Genomes
The overarching goal of my graduate work has been to gain better insight into
how chloroplast gene expression is regulated by the nuclear genome. In order to
appreciate this process one must first quickly review the evolution of the organelles (1-3).
The mitochondrion and chloroplast each arose as a result of an endosymbiotic event. First
the endosymbiosis of a proteobacterium gave rise to the mitochondrion; there is
consensus that this was a very early event during the evolution of the eukaryotic cell,
although there is controversy concerning whether it predated the evolution of the nucleus.
More recently (~1 billion years ago), the engulfinent of a cyanobacterium gave rise to the
chloroplast. As a consequence of these events, genetic material is found in three places in
the plant cell: the nucleus, the mitochondrion, and the chloroplast. The genomes ofthe
organelles are greatly diminished in comparison to those of their bacterial ancestors. This
has occurred through successive gene loss from the organelles, sometimes in conjunction
with gene transfer to the nuclear genome. Despite this gene loss, approximately 100
genes have been retained in the chloroplast genome in land plants. Most of these encode
proteins that are directly involved in either photosynthesis (e.g. subunits ofphotosystem
II, photosystem I, etc) or in chloroplast gene expression (e.g. tRNAs, rRNAs, ribosomal
proteins, and RNA polymerase subunits). Because some genes encoding subunits of the
photosynthetic complexes are found in the chloroplast, whereas others are encoded in the
nucleus, concerted expression of the chloroplast and nuclear genomes is required for
proper chloroplast function. The basis for the retention of some genes in the chloroplast is
2not fully understood but has been proposed to facilitate redox based regulation of protein
expression, wherein the photosynthetic status of the chloroplast can directly influence the
expression of chloroplast genes involved in photosynthesis (4).
The co-evolution of the chloroplast and the host cell resulted in two classes of
chloroplast targeted, nuclear encoded proteins: those derived from the ancestral
cyanobacterium and those derived from the host genome. Most nuclear genes of
cyanobacterial ancestry encode proteins that are targeted to the chloroplast, where they
carry out their ancestral function; these compensate for the loss of the orthologous genes
from the chloroplast. Host-derived proteins on the other hand lack relatives in bacteria;
they are thought to have evolved from proteins with functions outside of the chloroplast,
with subsequent co-opting to fulfill newly acquired needs of the chloroplast. In fact, the
chloroplast acquired many features that are not characteristic of its cyanobacterial
ancestor, and the emergence of these features seems to have been accompanied by the
"invention" of several new nuclear-encoded protein families that are dedicated to these
functions. Examples of this phenomenon are highlighted below.
RNA Metabolism in the Chloroplast
The complexity ofRNA metabolism in the chloroplast is much greater than that
in cyanobacteria (5). For example, chloroplast RNAs are modified by RNA editing,
terminal processing at both the 5' and 3' ends, group I and group II intron splicing, and
intercistronic processing of polycistronic precursors (reviewed in 6, 7). Furthennore,
most gene regulation is believed to occur at the post-transcriptional level, via modulation
of RNA stability and translation.
There are 18 introns in the maize chloroplast genome: one group I intron and 17
group II introns. These introns are classified as autocatalytic because members of both
groups in other organisms have been shown to self-splice in vitro. However, group I and
II introns in higher plant chloroplasts are incapable of self-splicing in vivo and require
3protein cofactors to facilitate splicing. In fact, it is thought that the nuclear spliceosome
evolved from the degeneration of group II introns accompanied by the co-evolution of
proteins to compensate for the loss of autocatalytic RNA activity. The splicing of
chloroplast group II introns requires many nucleus-encoded proteins, but these proteins
are not related to spliceosomal proteins, nor to the RNA binding protein classes that
function in the nuclear-cytosolic compartment or in bacteria (6, 8, 9).
RNA editing and the processing of polycistronic precursors to single gene
mRNAs are also characteristic of chloroplasts, but not oftheir bacterial ancestors. The
intercistronic processing events generate complex populations of RNAs from most
chloroplast genes, reflecting the full length polycistronic precursor, various processing
intermediates, and fully-processed monocistronic mRNAs. It had been speculated that
this processing arises through site-specific endonucleolytic cleavages, but our
laboratory's previous work, as well as results described in this thesis, suggested an
entirely different mechanism to account for the complex chloroplast transcript
populations.
Non-Canonical RNA Binding Proteins in the Organelles
Genetic approaches have been used to identify nucleus-encoded, proteins that
affect these various aspects of chloroplast RNA metabolism. A striking finding is that
the vast majority of such proteins are not related to the classic RNA binding proteins
found in the nuclear-cytosolic compartment. In fact, most of these proteins belong to
families that are dedicated to organeller gene expression. Some examples are the CRM,
DUF860, and PPR families of proteins (8-10). These proteins harbor non-canonical RNA
binding domains, with most or all family members targeted to the chloroplast or
mitochondrion. CRM and DUF860 proteins are involved in the splicing of many
chloroplast and mitochondrial introns, whereas the PPR family plays multiple roles in the
chloroplast and mitochondrion, including RNA splicing, RNA editing, translational
4control, and maintaining RNA stability. CRM and DUF860 proteins are plant-specific
whereas PPR proteins are found in all eukaryotes. However, there has been a large
expansion of the PPR family in plants; whereas there are ~10 PPR proteins in humans
and yeast, there are ~450 in land plants (11). Although these protein families play
essential roles in many aspects of organellar RJ\fA metabolism, very little is known about
the mechanisms by which they exert their effects.
To understand the mechanisms by which the non-canonical RNA binding proteins
characteristic of the chloroplast and mitochondrion mediate their effects, I have studied
three nuclear encoded proteins that are required for chloroplast biogenesis: WHY1,
PPRlO, and PPR5. All three ofthese proteins are targeted to the chloroplast, bind to RNA
with sequence specificity, and are involved in multiple steps in RNA processing. WHYI
and PPR5 facilitate group II intron splicing. PPR5 and PPRI0 protect RNA from
nucleases, and PPRI 0 also promotes translation. How WHYI exerts its downstream
effects is still a mystery. Our detailed study ofPPR5 and PPRI0, on the other hand, is
beginning to give us insight into how members of the PPR family can mediate multiple
downstream affects through one biochemical property: a long and specific RNA
interaction surface.
The work on WHYI (Chapter II) has been published and is co-authored by Jana
Prikryl, Kenneth P. Watkins, Giulia Friso, Klaas J. van Wijk, and Alice Barkan. The
work on PPR5 and PPRlO (Chapter III) is in preparation for publishing and will also be
co-authored by Jana Prikryl, Margarita Rojas, Rosalind Williams-Carrier, Omer Ali
Bayraktar, and Alice Barkan.
5CHAPTER II
A MEMBER OF THE WHIRLY FAMILY IS A MULTIFUNCTIONAL RNA AND
DNA BINDING PROTEIN THAT IS ESSENTIAL FOR CHLOROPLAST
BIOGENESIS
This chapter describes the characterization of a member of the plant specific,
Whirly protein family, WHYl. This work was done in collaboration with Dr. Alice
Barkan, and Dr. Kenneth Watkins. In addition, Dr. Giulia Friso, and Dr. Klaas van Wijk
contributed by using Mass Spectroscopy to identify the WHYI protein. This work has
been published and co-authored with the above-mentioned individuals.
Introduction
Plant mitochondria and chloroplast genomes encode ~50 and ~100 products,
respectively, most of which participate in basal organellar gene expression or energy
transduction. Post-transcriptional events play the dominant role in dictating gene product
abundance in both organelles (reviewed in 12). In fact, the two organelles house a similar
repertoire of RNA processing pathways that includes RNA editing, group II intron ,
splicing, and endonucleolytic processing. Genetic and bioinformatic analyses suggest that
many hundreds of nuclear genes encode organelle-localized nucleic acid binding proteins
and influence organellar gene expression (9, 11, 13, 14), but only a small fraction of such
genes has been studied.
The protein that is the focus of this study, ZmWHY1, came to our attention during
our characterization of the chloroplast RNA splicing machinery. Nine nucleus-encoded
6proteins that are necessary for the splicing of various subsets of the ~20 chloroplast
introns in vascular plants have been reported (15-24). One of the first to be
characterized, CRS 1, is necessary for the splicing of the group II intron in the chloroplast
atpF gene (15, 18), and binds specifically to that intron in vivo and in vitro (19, 20, 25).
However, the large size of the particles containing CRS 1 and atpF intron RNA in vivo,
and the fact that CRS 1 is not sufficient to promote atpF intron splicing in vitro suggested
that additional proteins are involved. We therefore used mass spectrometry to identify
proteins that coimmunoprecipitate with CRSl; ZmWHYl was one such protein.
ZmWHYl is a member of the "Whirly" protein family, whose orthologs in potato
(StWHYl) and Arabidopsis (AtWHYl) were reported to be nuclear transcription factors
involved in pathogen-induced transcription (26, 27). StWHYl and AtWHYI bind single-
stranded DNA in vitro, and StWHYI adopts a propeller-like structure from which the
family acquired its name (26, 28). AtWHYI has also been implicated in telomere binding
and maintenance (29). Additional functions for members of the Whirly family were
suggested by the fact that GFP fused to each member of the family from Arabidopsis
localizes to chloroplasts or mitochondria (30). The copurification of AtWHYl with a
transcriptionally-active chloroplast DNA complex (31) and the association of AtWHY2
with mitochondrial nucleoids (32) confirmed that these proteins have organellar
functions, but the nature of these functions is not known. Results presented here show
that ZmWHY1 plays an essential role in the biogenesis of chloroplasts, that it is
associated with DNA from throughout the chloroplast genome and that it interacts in vivo
with a subset of chloroplast RNAs that includes the atpF intron. ZmWHYl enhances
atpF intron splicing and influences the biogenesis of the large ribosomal subunit.
However, chloroplast DNA and RNAs in ZmWhyl mutants accumulate to levels similar
to those in other mutants with plastid ribosome deficiencies of similar magnitude. These
results argue that ZmWHY1 is required neither for chloroplast DNA replication nor
directly for global chloroplast transcription.
7Materials and Methods
Purification of eRSl ribonucleoproteins and mass spectrometry
Purification of CRS 1 ribonucleoprotein particles and mass spectrometry were
performed as described for CAF1 and CAF2 particles in ref (21). The antibody to CRS1
was described previously (20).
Plant material
Our collection of Mu transposon-induced non-photosynthetic maize mutants
(http://chloroplast.uoregon.edu) was screened by PCR to identify insertions in ZmWHYl,
using methods described in (33) and a ZmWhyl-specific primer (5'-
CGGCGGCCTTTCTGGAGGA -3') in conjunction with a Mu terminal inverted repeat
primer (5'- GCCTCCATTTCGTCGAATCCCG -3'). The alleles were tested for
complementation by crossing phenotypically normal siblings (+/+ or +/-) from ears
segregating each allele. 74 ears were recovered, 36 of which segregated chlorophyll
deficient mutants. Other mutants used in this work include iojap (34), hcj7 (35), and crsl
(15). The inbred line B73 (Pioneer HiBred) was used as the source of wild type tissue for
coimmunoprecipitation, sucrose gradient, and chloroplast fractionation experiments.
Plants were grown in soil in a growth chamber (16h light, 24°C) / 8h dark, 19°C). Leaf
tissue was harvested ~9 days after planting.
Generation of recombinant ZmWHYl for antibody production and binding assays
ESTs representing ZmWhyl were identified as GenBank accessions DV170433
and DV503865; the corresponding cDNAs were obtained from the maize full-length
cDNA project (http://www.maizecdna.org/). The complete cDNA sequence was
detemiined and has been entered in GenBank under Accession EU595664. A ZmWHYl
protein fragment (amino acids 86 to 258) with a C-termina16x-histidine tag was
expressed in E. coli from pET28b (Novagen), purified by nickel affinity chromatography
and used for the production ofpolyclonal antisera in rabbits at the University of Oregon
8antibody facility. Full-length mature ZmWHYl (i.e. lacking the transit peptide) for
nucleic acid binding assays was generated by PCR amplification of its coding sequence
from the cDNA (primers 5'- TATAGGATCCGCCTCCTCCCGTAAG -3' and 5'-
TATAGTCGACTCACCGACGCCATTC -3'), digestion of the product with BamHI and
SalI, and cloning into pMAL-TEY. Subsequent steps in expressing and purifying
recombinant ZmWHYl were as described previously for RNCI (21).
Chloroplast fractionation and protein analysis
Leaf protein extracts were prepared and analyzed as previously described (36).
Chloroplast subfractions were those described by Williams and Barkan (33). For RNAse
and DNAse treatment ofthylakoid membranes, MgCh was added to a thylakoid
membrane fraction to a concentration of 15 rnM. The sample was divided into three 20 III
aliquots: 1 III RNAse-free RQl DNAse (IU/Ill) (Promega), 1 III ofRNAse A (1 1lg!1ll),
or 1 III water was added for the DNAse, RNAse, and mock treatments, respectively.
Samples were incubated at room temperature for 30 min and then centrifuged at 4°C at
15,000 x g for 15 min. The pellet was resuspended in 10 mM Tris-HCl pH 7.5, 2 rnM
EDTA, 0.2 M sucrose, to a volume equivalent to that of the supernatant. The supernatant
and pellet fractions were analyzed by SDS-PAGE and immunoblotting. Sucrose gradient
sedimentation of stromal extract was performed as described by Jenkins and Barkan (16);
aliquots of stroma were treated with either 3 units RQ 1 DNAse or 50 Ilg/ml RNAse A for
30 min at room temperature prior to centrifugation. Antisera to spinach chloroplast RPL2
and MDH were generously provided by A. Subramanian (University of Arizona) and
Kathy Newton (University of Missouri), respectively. The other antibodies were
generated by us and described previously (37).
Nucleic acid coimmunoprecipitation assays
100 III aliquots of stromal extract (~500 Ilg of protein) were analyzed by RIP-
chip, DIP-chip, and slot-blot hybridization using methods described in (38), except that
stroma used for RIP-chip assays was treated with DNAse prior to immunoprecipitation
9(10 units RQ1 DNAse at 37 ·C for 30 min) and again after purification of nucleic acids
from the immunoprecipitation. For DIP-chip assays, RNAse A (100 Ilg/ml final
concentration) was added to stroma prior to immunoprecipitation and residual RNA was
removed from the recovered nucleic acids by alkali hydrolysis in 200 mM NaOH at 70 ·C
for 30 min.
Analysis of DNA and RNA
DNA extraction from leaf tissue and Southern blot analysis were performed as
previously described (39). Leaf RNA was extracted from the middle of the second leaf of
9 day old seedlings, with Tri Reagent (Molecular Research Center). RNA gel blot
hybridizations were performed as previously described (36). The following PCR
fragments were used as probes (residue numbers refer to GenBank accession X86563):
atpF int/ex2, 35706-36384; atpF int, 36073-35233; ndhA int, 114941-115730; orf99,
86911-88430;petD ex2, 75539-75895;petN, 19081-19415;psbA, 296-1074; rp116 ex2,
79519-79920; rp116 int, 80002-80888; rpoB, 23258-24475; rps12 trans, 69307-69420
and 129636-129861; rps12 intl/exl, 5',68793-69460; rps14, 38500-39020; rrn4.5,
102041-102135; rrn5, 102180-102619; rrn16, 95559-96779; rrn23, 98332-98792; trnA
mature, 98038-98075 + 98712-98916; trnG mature, 13245-13292 and 13991-14013;
trnG int 13293-13990; trnN, 103066-103137; ycj3 int2/ex3, 43820-44873; ycj3 int,
44383-45116. Poisoned primer extension assays to distinguish mature from precursor
RNAs were performed as previously described (18) using the following primers and
dideoxynucleotide: rm23, 5'- CGCAAGCCTTTCCTCTTTT -3' (ddTTP); rp12, 5'-
GGCCGTGCCTAAGGGCATATC -3' (ddCTP); rps12, 5'-
GGTTTTTTGGGGTTGATAG -3' (ddCTP). Radioactive gels and blots were imaged
with a phosphorimager and analyzed using ImageQuant software (GE Healthcare).
Nucleic acid binding assays
Gel mobility shift assays were performed with the same substrates an~ procedures
as described in Watkins et al. (2007) (21) except that the binding reactions contained 150
10
mM NaC!, 5 mM DTT, 50 j.lg/m1 BSA, 25 mM Tris-HCl pH 7.5,0.1 mg/ml Heparin.
Filter binding assays were based on the procedure of Wong and Lohman (40) with
modifications (25). The atpF intron RNA substrate for filter-binding assays was
transcribed in vitro by T7 RNA from a PCR product generated with the following
primers: atpF forward /T7 promoter, 5'-TAATACGACTCACTATAGGGATGAAAAA
TGTAACCCATTCTT -3'; atpF reverse, 5'- AATGAAAGTAGATTATCTTGC -3'. The
RNA, which included atpF exon 1 and the complete intron, was heated in TE to 90°C for
2 min and then placed on ice immediately prior to its addition to binding reactions (300
mM NaC!, 5 mM DTT, 50 j.lg/ml BSA, and 25 mM Tris pH 7.5, 30°C for 30 min).
Chloroplast run-on transcription assay
The chloroplast run-on transcription assay was performed as described by Mullet
and Klein (41-43). The radiolabeled products were hybridized to the following synthetic
oligonucleotides (10 pmol/slot) that had been applied with a slot-blot manifold to a nylon
membrane: rrn16 5'-
CCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGG -3',
rrn23 5'- GGACTCTTGGGGAAGATCAGCCTGTTATCCCTAGAGTAACTTTTATC
CGA -3', trnG 5'- CATCTATGTCAGCTTTTCTGTCTGAATGGAACCAAAGCTCTC
CGCTTTCTAGATGC -3', and CFM3 5'- ATACTCGAGCGAAAAACAGGAGGATT
AGTAATCTGGCGATCAGGGACTTCTGTTTCTCTGTACCGGGGAGTAGATTATG
ATGAACC -3'.
Results
Identification of ZmWHYl in CRSl coimmunoprecipitates
To find proteins involved in the splicing of the atpF intron we used mass
spectrometry to identify proteins that coimmunoprecipitate with the atpF splicing factor
CRS 1. Stromal extract was initially fractionated on a sucrose gradient, and the fractions
11
that contained the majority of the CRSI ribonucleoprotein particles (~600-700 kDa) were
used for immunoprecipitation. The immunoprecipitated proteins were separated by SDS-
PAGE, and contiguous gel slices containing proteins between ~20 and ~120 kDa were
used for in-gel trypsin digests and tandem mass spectrometry. Among the proteins
identified was a member ofthe Whirly protein family (Supplementary Table I,
Supplementary Figure IA) (26, 28). The Whirly protein family in vascular plants
includes two orthologous groups (Supplementary Figure IB). The peptides detected in
the CRS 1 coimmunoprecipitate identified the protein as a member of the orthologous
group designated Whyl.
Recovery of ZmWhyl insertion mutants
To elucidate the function of ZmWHY1 we sought insertion mutants in a reverse-
genetic screen of our collection of transposon-induced non-photosynthetic maize mutants
(http://pml.uoregon.ed!!L). Two mutant alleles were recovered (Figure I): the Zmwhyl-l
allele has a MuDR transposon insertion 35 bp downstream of the predicted start codon
and conditions an ivory leaf phenotype; the Zmwhyl-2 allele has a Mul or Mul. 7
insertion 38 bp upstream ofthe predicted start codon and conditions a pale green leaf
phenotype. The heteroallelic progeny ofcomplementation crosses (Zmwhyl-l/-2) exhibit
an intermediate phenotype (Figure IB). Homozygous mutant plants die after the
development of three to four leaves, as is typical of non-photosynthetic maize mutants.
A polyclonal antibody was raised to a recombinant fragment ofZmWHYI. This
antibody detected a leaf protein whose size is consistent with that anticipated for
ZmWHYI (~25 kDa) (data not shown) and whose abundance is reduced in ZmWhyl
mutants (Figure IC), indicating that the detected protein is ZmWHYI. The ZmWHYI
antibody coimmunoprecipitated CRS1 (Figure ID) from chloroplast extract, confmning
that CRS 1 and ZmWHYI associate with one another. This association was disrupted by
treatment with ribonuclease A (Figure ID), indicating it is mediated by RNA. Results
described below show that atpF intron RNA, which was shown previously to associate
with CRSI in vivo (19, 20), mediates the CRSI/ZmWHYI interaction.
12
Figure 1. Mutant Alleles ofZmWhy1.
(A) Positions of Mu transposon insertions in the ZmWhy1 gene. Protein coding regions
are indicated by rectangles, untranslated regions and introns by lines, and Mu transposon
insertions by triangles. The sequence of each insertion site is shown below, with the nine
nuc1eotides that were duplicated during insertion underlined. The identity of the member
of the Mu family is shown for each insertion (whyl-2: Mull!.7; why1-1: MuDR), and
was inferred from polymorphisms in the terminal inverted repeats.
(B) Phenotypes ofZmWhy1 mutant seedlings grown for nine days in soil. Seedlings
shown are homozygous for either the Zmwhy1-1 or Zmwhyl-2 allele, or are the
heteroallelic progeny of a complementation cross.
(C) Immunoblot showing loss ofZmWHY1 in mutant leaf tissue. Total leaf extract (10
Ilg protein, or dilutions as indicated) were analyzed. The same blot stained with Ponceau
S is shown below, with the large subunit of Rubisco (RbcL) marked. hej7 and iojap are
pale green and albino maize mutants with weak and severe plastid ribosome deficiencies,
respectively (34, 35). The apparently higher levels of ZmWHYI in Zmwhy1-1 mutants
relative to Zmwhyl-2 mutants may be an artifact of the fact that samples were loaded on
the basis of equal total protein: the abundant photosynthetic enzyme complexes make up
the bulk of the protein in the Zmwhyl-2 extract but are missing in the Zmwhy1-1 extract,
causing other proteins to appear over-represented.
(D) RNA dependent coimmunoprecipitation of ZmWHYI with CRS 1. Prior to
immunoprecipitation, stroma was treated with DNAse or RNAse, or incubated under
similar conditions without added nuclease (Mock). The stroma was then subjected to
immunoprecipitation with the antibody named at top. Presence of CRS 1 in the
immunoprecipitation pellets was tested by immunoblot analysis with CRS 1 antibody.
A why1-1
"j,l •
why1-2
•~--!H •
200 bps
13
c
why1-2, Mu 1 or 1.7 -20
glctgagcc gcctgtctcctcctcgttetctcagcccgttcggcgca
'1"1
ATGocaccgccggcgccgctettcctctcgctcgc c:tccacRcc
why1-1, MuDR
B
....
I
.......
C\I C\I.... WT
I I I
.... .... .... 0~ ~ _ff__ i :~~ ~ ~ ~
aWHY1
RbcL-
aWHY1 aCRS1 aOE16
14
ZmWHYl partitions between the chloroplast stroma and thylakoid membrane, to
which it is bound in a DNA-dependent manner
ZmWHY1 was initially recovered from chloroplast stroma and is predicted to
localize to chloroplasts by both the TargetP (44) and Predotar (45) algorithms.
Immunoblot analysis ofproteins from leaf, chloroplasts, and mitochondria confirmed that
ZmWHY1 is found in chloroplasts and that it is absent, or found at only very low levels,
in mitochondria (Figure 2A). Analysis of chloroplast subfractions showed that
ZmWHY 1 is recovered in both the stromal and thylakoid membrane fractions (Figure
2A); this behavior differs from that of other chloroplast gene expression factors using the
same fractionated chloroplast preparation (PPR2, PPR4, RNCl, CAF1, CAF2, CFM2),
all of which were found solely in the stromal fraction (17, 19,21,24,33).
It seemed possible that ZmWHYl associated with the thylakoid membrane via a
DNA tether because chloroplast nucleoids are membrane-associated (46) and AtWHY1
copurified with a chloroplast chromosome preparation (31). In support of this possibility,
treatment of the thylakoid membrane fraction with DNAse released a portion of the
membrane-associated ZmWHY 1 to the soluble fraction (Figure 2B), whereas RNAse
treatment had no effect. These results indicate that ZmWHY1 is associated with the
thylakoid membrane, at least in part, via an association with chloroplast DNA.
ZmWHYl is associated with large RNA- and DNA-containing particles
The observations that RNAse and DNAse disrupt ZmWHY1 's association with
CRS 1 and the thylakoid membrane, respectively, suggested that ZmWHY1 associates
with both RNA and DNA. To further explore the nature of these interactions, the effects
of RNAse or DNAse treatment on the sedimentation properties ofZmWHY1 were
investigated (Figure 3). When untreated stroma was sedimented through a sucrose
gradient, ZmWHY1 was detected in two peaks (~400-500 kDa and ~600-700 kDa) and
was also found in pelleted material at the bottom of the gradient. The 600-700 kDa peak
coincides with the peak of CRS 1 in the same gradient. Treatment of stroma with DNAse
reduced the amount of ZmWHY1 in the pellet and in the ~400-500 kDa peak, but did not
15
reduce its recovery in the 600-700 kDa peak. Conversely, RNAse treatment specifically
reduced the recovery ofZmWHY1 in the 600-700 kDa peak. These results together with
Figure 2. Intracellular Localization ofZmWHY1.
(A) Immunoblots of extracts from leaf and subcellular fractions. The samples in the
chloroplast (Cp) and chloroplast subfraction lanes are derived from the same initial
number of chloroplasts. The same blot was probed to detect a marker for thylakoid
membranes (D1) and mitochondria (MDH). These subcellular fractions are the same as
those shown previously for localization of RNC 1, where a marker for the envelope
membrane fraction was also presented (21). Env, envelope; Mito, mitochondria; Thy,
thylakoid membranes. The blot stained with Ponceau S is shown below, with the band
corresponding to RbcL marked.
(B) DNA-dependent association ofZmWHY1 with thylakoid membranes. The thylakoid
membrane fraction was treated with DNAse, RNAse, or incubated under similar
conditions without added nuclease (Mock). Thylakoid membranes were then pelleted by
centrifugation. Pellet (Pel) and supernatant (Sup) fractions were brought to equal
volumes, and an equivalent proportion of each fraction was analyzed on an immunoblot
probed with ZmWHY1 antibody. The same blot stained with Ponceau S is shown below.
>- a. a. Q,
~ Q) ~ Q) ~ Q) ~
~ a.. (/J 0.. (/J a.. (/J
Mock DNAse RNAse
__ _ __ -i::;~
Ponceau
EnvA
>c:
w B
olj
-Q)-.-~-~- ~ ~
1U.sQ.~~~ee>-~ ~ 0 () 0 .E US (;) F aWHY1
aWHY1 W';',:y . .- I
aD11_ -- - 01
aMDHI - IRbcl-. 'ii~j
Ponceau
those described above suggested that ZmWHY1 resides in two types of complexes: one
that includes CRS 1 and RNA, and the other that includes DNA.
16
Figure 3. Sucrose-gradient sedimentation demonstrating that ZmWHY1 is associated
with DNA- and RNA-containing particles in chloroplast stroma.
Stromal extract was treated with DNAse or RNAse, or incubated under similar conditions
without nuclease (Mock), and then sedimented through a sucrose gradient. An equal
volume of each gradient fraction was analyzed by probing immunoblots with the
antibodies indicated to the left. RPL2, a protein in the large ribosomal subunit, marks the
position of ribosomes. Shown below is the blot of the mock-treated fractions stained
with Ponceau S, with the RbcL band marked to illustrate the position of Rubisco. The
Ponceau S stained blots of experiments involving the DNAse and RNAse treated extracts
looked similar (data not shown).
Sedimentation
1 2 3 4 5 6 7 8 9 101112 PaCRS1_··~."_"'WIIlI~
aWHY1 ';;'\~"'".1"1.111 '!Wu =- ~
-
aCRS11:iI-c -i.........._I~
aWHY11 ...,...........--_. .........!il ~
CD
------_..-
s:
o(")
"
Rubisco Ribosomes
17
Coimmunoprecipitation assays demonstrate that ZmWHYl associates with a subset
of plastid RNAs that includes the atpF intron
The RNA-dependent association between ZmWHY1 and CRS 1 suggested that
ZmWHY might associate with CRS1's RNA ligand, the atpF intron. However, the
albino phenotype conditioned by the Zmwhy1-1 allele indicated that this could not be
ZmWHYI 's sole ligand, because mutations in crsl that completely block atpFintron
splicing result in a much less severe chlorophyll deficiency (20). To identify RNAs that
associate with ZmWHY in vivo we used a "RIP-Chip" assay (47) as an initial screen:
RNAs that coimmunoprecipitate with ZmWHY1 from stromal extract were identified by
hybridization to a tiling microarray ofthe maize chloroplast genome. To ensure that
DNA associated with ZmWHY did not contribute to the signal, the extract was treated
with DNAse prior to immunoprecipitation, and the nucleic acids recovered from the
immunoprecipitation pellet and supernatant were again treated with DNAse. RNAs
recovered from the pellet and supernatant were then labeled with red- or green-
fluorescing dye, respectively, combined, and hybridized to the microarray. Two replicate
immunoprecipitations were analyzed in this manner. To highlight sequences that are
enriched in the ZmWHY1 immunoprecipitations, the median enrichment ratio
[red(F635)/green (F532)] was plotted according to chromosomal position, after
subtracting the median enrichment ratios from control assays (Figure 4A). The results
highlight the atpF intron as the major RNA ligand of ZmWHY. The results suggested, in
addition, an association between ZmWHY1 and RNAs derived from several other loci
(e.g. rps14, rpoC, ycj3, rps12,petD, rp116, orf99). When the same data were analyzed by
considering only the signal in the immunoprecipitation pellets, the results were similar
(Supplementary Figure 2A).
To validate candidate RNA ligands to emerge from the RIP-chip experiment,
RNAs that coimmunoprecipitate with ZmWHY1 were analyzed by slot-blot hybridization
using probes corresponding to each RIP-chip peak (Figure 4B). RNAs purified from
immunoprecipitations with antibodies to CRSI and OE16 (a protein that does not bind
RNA) were analyzed as controls. As for the RIP-chip assays, the stromal extract was
18
Figure 4. Identification of chloroplast RNAs and DNAs that coimmunoprecipitate with
ZmWHYl.
(A) RIP-chip data showing coimmunoprecipitation of specific chloroplast RNAs with
ZmWHYl. The ratio of signal in the pellet versus the supernatant (F635/F532) for each
array fragment is plotted according to chromosomal position. The plot shows the median
values for replicate spots across two replicate ZmWHY1 immunoprecipitations after
subtracting the corresponding values for two negative control immunoprecipitations (one
with OE16 antibody and one without antibody). The same data are plotted using an
alternative analysis method in Supplemental Figure 2B; the atpF intron is the most
prominent peak in both analyses, but the proportional sizes of other peaks vary depending
on the comparison used.
(B) Validation of RIP-chip and DIP-chip data by slot-blot hybridization. Stroma was
pretreated with DNAse or RNAse or left untreated and then subjected to
immunoprecipitation with the antibodies indicated at the top. Nucleic acids purified from
the pellets (Pel) and supernatants (Sup) were further treated with DNAse or alkali to
remove residual DNA or RNA. The resulting total nucleic acids (T), RNA (R), or DNA
(D), were applied to a nylon membrane with a slot blot manifold and hybridized with
probes specific for the indicated sequences. 1I9th and 1/27th of the nucleic acid recovered
from each pellet and supernatant, respectively, was applied to each slot.
(C) DIP-chip data showing genome-wide enrichment of chloroplast DNA in ZmWHYl
immunoprecipitations. Stroma was treated with RNAse prior to immunoprecipitation.
Nucleic acids were extracted from the immunoprecipitation pellets and from total input
stroma, and subjected to alkali hydrolysis to remove residual RNA prior to analysis by
microarray hybridization. The median log2-transformed ratio of fluorescence in the pellet
19
A
~ ~- -~--- - ~~-~~~-~~--- - ~ ~~~~- -~ -~-~-------- ~---~~----------~ --------~~~-,
200100 t50
F....... '/chi.........
50
D.9,.------------------------,
,.,.""h;;
III , D~"
I .. D.'
11 ~ D.2
iJI D.l \yJ"
,~ 0 too-w/ItII#
. ·D.t ~_----'-..:.--~ ______'
o
B
aOE16 aCRS, aWHY1
---
TROTRDTRO
a Flnt
t • • • • It. •
• I t
aOe16 uCRS, aWHY,
-----
TROTRDTRD
".f2lntf '.f. S'
'I""','. , I •• I • Supl'IPel
~.. SupPel
1_'_'_',;,.,.'_'_'_._•.........l:1f II .: I;1 f_'_1_'_1_'_._._~~......:I:;
c
~ 0I :: -aWHY,
1 .;,
Ii ...
r .5
I :~--aCAF~...I~~~~
j
o 100 '10
..........',...........-..
20
treated with DNAse prior to immunoprecipitation and the nucleic acids recovered from
the immunoprecipitation were treated again with DNAse. The results largely
recapitulated the RIP-chip data (see lanes "R" in Figure 4B): atpF intron RNA was
confirmed to be strongly enriched in ZmWHYl immunoprecipitations, whereas RNAs
from the psbA and petN loci, which did not appear as positives in RIP-chip assays,
likewise scored negative in the slot-blot hybridization assay. Coimmunoprecipitation with
ZmWHYl was also confirmed for RNAs from the rps12, ndhA, rp116, ycj3, and rps14
loci; as predicted by the RIP-chip data, their degree of enrichment was less than that for
the atpF intron. However, RJ"JAs from the petD, orj99, and rrn5 loci, which appeared as
minor peaks in the RIP-chip data, did not appear to be enriched based on the slot-blot
data; the orj99 transcript is ofvery low abundance, however, so it may be enriched in the
pellet at levels that are too low to detect. These issues not withstanding, the RIP-chip and
slot-blot hybridization data together show that ZmWHYl associates with a subset of
RNAs in chloroplast extract, and that the atpF intron is its major RNA ligand.
DNA from throughout the plastid genome coimmunoprecipitates with ZmWHYl
The effects ofDNAse-treatment on ZmWHYl 's association with the thylakoid
membrane (Figure 2B) and on its sedimentation rate (Figure 3) indicated that ZmWHYl
is associated with chloroplast DNA in vivo. To gain insight into which DNA sequences
were involved in these interactions, we modified the RIP-chip protocol to detect
coimmunoprecipitating DNA (DIP-chip): stromal extract was treated with ribonuclease
prior to the immunoprecipitation, and alkali hydrolysis was used to remove residual RNA
after the immunoprecipitation. A control immunoprecipitation used antibody to CAF 1, a
splicing factor that associates with specific chloroplast intron RNAs in vivo (19). Both
ZmWHYl and CAFI were efficiently immunoprecipitated (Supplementary Figure 2C),
but the DIP-chip data were strikingly different (Figure 4C): nearly all of the DNA in the
input stromal sample coimmunoprecipitated with ZmWHY1, whereas very little DNA
was recovered in CAFI immunoprecipitations. These results confirm that ZmWHYl is
associated with chloroplast DNA and show further that ZmWHY1 either binds
21
throughout the chloroplast genome, or binds to specific DNA regions and
coimmunoprecipitates all other DNA sequences due to their linkage to ZmWHY1
binding sites. Incubation of the extract with various restriction enzymes prior to the
immunoprecipitation did not reveal the specific enrichment of any DNA sequences
(Supplementary Figure 2B), leading us to favor the interpretation that ZmWHY1 is
associated with many sites throughout the chloroplast genome. Nucleic acids recovered
from the CAF1 and ZmWHY1 immunoprecipitations were also used as a direct template
for PCR (Supplementary Figure 2D). The results support the DIP-Chip data: PCR
product was obtained using a variety of chloroplast genome primers from the ZmWHY1
coimmunoprecipitation and not from the CAF1 coimmunoprecipitation.
The enrichment of DNA sequences in ZmWHY1 immunoprecipitations was
further confirmed by slot blot hybridization (Figure 4B). As for the DIP-chip assays,
stroma was treated with RNAse prior to the immunoprecipitation, and residual RNA was
removed by alkali hydrolysis after the immunoprecipitation (Figure 4B, lanes "D").
Antibody to ZmWHY1 coimmunoprecipitated DNA from all sequences tested, whereas
DNA was not detected in either the CRS1 or OE16 immunoprecipitations. The DIP-chip,
PCR, and slot-blot hybridization data provide strong evidence that ZmWHY1 is
associated with chloroplast DNA in vivo and that it has many binding sites throughout the
genome.
Zm Whyl mutants are deficient for plastid ribosomes
A role for WHY1 in chloroplast gene expression was suggested by the
coimmunoprecipitation ofZmWHY1 with CRS 1, RNA and DNA, and by the
copurification ofAtWHY1 with the plastid transcriptionally-active-chromosome (31). In
support of this possibility, core subunits of the chloroplast ATP synthase, photosystem II,
photosystem I, the cytochrome b6fcomplex, and Rubisco accumulate to reduced levels in
ZmWhyl mutants (Figure 5B). The protein deficiencies conditioned by the weak allele
combinations (Zmwhyl-2/-2 and Zmwhyl-l/-2) resemble those in hcj7mutants, which
have a reduced content of chloroplast ribosomes (35).
22
Figure 5. Plastid ribosome deficiency in ZmWhyl mutants.
(A) Total seedling leaf RNA (0.5 "",g) was analyzed by RNA gel blot hybridization using
probes for the RNAs indicated at the bottom. A map of the plastid rRNA operon is shown
below. A cDNA probe was used to detect mature trnA; this lacks intron sequences and
therefore hybridizes poorly to unspliced precursor. The probe for 23S rRNA is derived
from the 5' portion of the rrn23 gene and detects just one of the two 23S rRNA
fragments found in ribosomes in vivo. The leaf pigmentation conditioned by each mutant
allele is indicated: iv, ivory leaves; pg, pale green leaves. The blot used to detect 16S
rRNA is shown after staining with methylene blue to illustrate equal loading of cytosolic
rRNAs (I8S, 28S). Mature RNA forms are indicated with asterisks.
(B) Reduced accumulation of photosynthetic enzyme complexes in ZmWhy1 mutants.
Immunoblots of leaf extract (5 J.lg protein or the indicated dilutions) were probed with
antibodies to core subunits of photosynthetic enzyme complexes: AtpA (ATP synthase),
Dl (photosystem II), PsaD (photosystem I), and PetD (cytochrome brfcomplex). The
same blot stained with Ponceau S is shown below to illustrate sample loading and the
abundance of RbcL.
(C) Plastid run-on transcription. Chloroplasts prepared from Zmwhyl-l/-2 heteroallelic
mutants or their normal siblings (WT) were used for run-on transcription assays as
described in Methods. RNAs purified from the reactions were hybridized to slot blots
harboring oligonucleotides corresponding to the genes indicated at the top. Each probe
was present in duplicate. elm3, a nuclear gene, served as a negative control. The results
were quantified with a phosphorimager and plotted on the bar graph below.
versus the input is plotted for replicate array fragments as a function of chromosomal
position. The left inset shows the recovery of CAP1 and ZmWHY1 in the
immunoprecipitations: the antibody used for immunoprecipitation is indicated above, and
the antibody used to probe the immunoblot is shown to the left. Coimmunoprecipitated
DNAs were also used as template for PCR using primers at several positions in the
chloroplast chromosome (right inset) The fragment #s correspond to those on the
mlCroarray.
"C
co
;8
*
WT
hefl
ers1-2
why1-2
1 Iwhy1-2 /-1
~~y1-1 I__
I ,'Ojap <
WT
hefl
ers1-2
why1-2
why1-2 /-1
,,:,~y1-1 1_'
I ,lOJap <
-- .. .. ..
~
::i
0'1
,
~
.... ~!_...l•....i.•',~Iii "' __ .
<.n .,11. III !rll
..... l\:)
0) 0) ;-'!'> ~~ '" »en en 0 0 00 0-
f • • ... ••
~l' WT
:T r It hefl
'< t ~.. ers1-2~ r ~.. why1-2 1;8
~I ~ (0) II why1-2 / -1
::i E 1 why1-1 I~ CD. I iojap <'
'~WT
hefl
=:tI ;:;J I~- . I~~:1:2 l;g
::!. ~ ~ •. why1-2 /-1
,,:,~y1-1 1_'31 '--------:-,-::'1""--'-1-'-I, :; <
hi I hefl
~I ~ .. ~. ~~:1:2 1;8
~ t.\) \ tl why1-2 / -1
CIJ ,,:,~y1-1 1_'IOJap <
~
i
~<.n
::i
0'1
OJ
o
~
R ~
o .g
~ »
_ WT
r hef7
_" _ : Iwhy1-2
I, lit II i Iwhy1-2 / -1
Iwhy1-1
iojap
6%
12% IS:
'1 25% .:::jI: 100%
RR
-0-0m.~00
Signal x1000
~ ~ I\)
~Qi)l\)mo
I '
·.·~.rrn16
~ ' .. '
::r • "", rrn23~"_.j ~"
I ."': ~.
~ '" trnG
I
'I. I ..... ;efm3
::IJg
r
.~
~
'"-4I
~
I
-.L
IV
w
24
These proteins were not detectable in Zmwhy1-1 homozygotes, as in albino iojap mutants
which lack plastid ribosomes (Figure 5B).
The global loss of photosynthetic enzyme complexes in ZmWhyl mutants
suggested an underlying loss of plastid ribosomes. This possibility was confirmed by
RNA gel blot hybridizations, which showed a loss of mature 23S, 4.5S, and 16S rRNAs
in hypomorphic ZmWhy1 mutants, and an increased accumulation ofrRNA precursors
(Figure 5A). Chloroplast rRNAs were not detectable in plants homozygous for the null
Zmwhy1-1 allele, as in albino iojap leaves. Whereas hej7 mutants show a more severe
loss of 16S rRNA than 23S and 4.5S rRNAs, the reverse is true for hypomorphic
ZmWhyl mutants. A dramatic increase in the ratio of 23S rRNA precursors to mature
23S rRNA in these mutants was confirmed with a poisoned-primer extension assay
(Supplementary Figure 3C).
Some steps in rRNA processing are dependent upon ribosome assembly in
chloroplasts, as in bacteria (see, for example, refs. (24, 35,48)). The aberrant 23S and
4.5 S rRNA processing in ZmWhy1 mutants suggested therefore that ZmWHYI might
promote the expression of a gene needed for the assembly of the large ribosomal subunit
(an rRNA or ribosomal protein), with loss of the small ribosomal subunit being a
secondary effect. It seemed plausible, for example, that ZmWHYI might promote
processive transcription through the chloroplast rrn operon; this would differentially
affect the large ribosomal subunit due to the distal position of the genes encoding its
rRNA components (23S, 4.5S, and 5S rRNA) in the operon (see map in Figure 5A).
However, the results of chloroplast run-on transcriptions assays argue against this
possibility (Figure 5C): the ratio of polymerase transit through the 23S gene in
comparison to the 16S rRNA gene, and the ratio of rrn operon transcription in
comparison to transcription from a different chloroplast locus (trnG-UCC) were similar
in wild-type and Zmwhyl-l/-2 mutant chloroplasts. Furthermore, the rRNA components
of the large ribosomal subunit were not reproducibly enriched in ZmWHY co-
immunoprecipitates (Figure 4A, Supplementary Figure 2B); this suggests that ZmWHY1
does not interact directly with rRNAs or 50S ribosomal subunits, although such
25
interactions cannot be eliminated based on these negative results. Taken together, these
results argue that ZmWHYl directly impacts the expression of a gene encoding a
component of the large ribosomal subunit and/or promotes ribosome assembly.
Elucidation of its precise role in this process will require further study.
ZmWHYl promotes atpF intron splicing
The coimmunoprecipitation ofZmWHYl with the atpF splicing factor CRS1 and
with RNA from the atpF locus suggested that ZmWHYl might be involved in the
splicing of atpF pre-mRNA. To test this possibility, atpF RNA from Zmwhyl mutants
was analyzed by RNA gel blot hybridization (Figure 6). To control for pleiotropic effects
of weak and severe plastid ribosome deficiencies, RNAs in pale green (hypomorphic)
Zmwhyl-2 and Zmwhyl-2/-1 mutants were compared to those in hcj7 mutants, and
RNAs in albino (null) Zmwhyl-l mutants were compared to those in iojap mutants.
These comparisons were important because the complete absence of plastid ribosomes
results in the failure to splice all chloroplast subgroup IIA introns, including the atpF
intron (15, 49, 50).
The results in Figure 6 show that the ratio of spliced (S) to unspliced (D) atpF
transcripts is reduced in hypomorphic ZmWhyl mutants in comparison to wild-type and
hcj7 plants, albeit not as severely as in crsl mutants. The ratio of excised intron
(asterisks) to unspliced RNA is also reduced, supporting the interpretation that ZmWHYl
promotes atpF splicing rather than stabilizing the spliced product. The normal splicing of
the atpF intron in hcj7 mutants argues that the partial plastid ribosome deficiency in
hypomorphic ZmWhyl mutants cannot account for their reduced atpF splicing.
Furthermore, a different subgroup IIA intron, the rp/2 intron, is spliced normally in the
same plants (Supplementary Figure 3B), showing that not all subgroup IIA introns are
affected in the hypomorphic ZmWhyl mutants. These results provide strong evidence that
ZmWHYl's association with atpFRNA enhances the splicing of the atpFintron.
26
Figure 6. Reduced atpF intron splicing in ZmWhyl mutants.
RNA gel blot analysis of atpF splicing. Total seedling leaf RNA (5 ~g) was analyzed by
RNA gel blot analysis using a probe including atpF exon 2 and a portion of the atpF
intron (atpF int/ex2), or with an intron-specific probe (atpFint). The atpF gene is part of
a polycistronic transcription unit that gives rise to a previously-characterized population
ofRNAs (51, 52). Spliced (S) and unspliced (D) transcripts are indicated. Asterisks mark
bands that we believe correspond to the excised intron and its degradation products. The
ratio of spliced to unspliced transcripts was quantified with a phosphorimager,
normalized to the wild-type ratio, and plotted below using arbitrary units.
iv pg pg iv
kb
10.0_
8.0-
6.0-
4.0-
3.0-
2.0-
1.5-
1.0-
atpF int/ex2
S/Ur----------,
1.0
0.8
0.6
0.4
0.2 -
'NT hcf7 crs1 why1 why1
-2 -2/-1
atpF int
27
The coimmunoprecipitation data demonstrated an association between ZmWHYl
and RNAs from several loci other than atpF. However, RNA gel blot hybridizations
showed that the transcripts from all such genes were qualitatively similar in ZmWhyl
mutants and in the relevant control mutant (Figure 7). The coimmunoprecipitation of
ZmWHYl with RNAs from both loci encoding the trans-spliced group II intron in rps12
was intriguing (Figure 4A), but splicing of this RNA is not disrupted in ZmWhyl mutants
(Supplementary Figure 3B). These results show that ZmWHYl is not necessary for the
normal processing of most chloroplast transcripts.
A structural homolog of ZmWHYl in Trypanosoma brucei is required for mitochondrial
RNA editing (53). Several plastid RNAs that are known to be substrates for RNA editing
were represented among the RNAs that coimmunoprecipitate with ZmWHYl. Direct
sequencing of RT-peR products demonstrated, however, that the editing of the known
edited sites in the petB, rp120, ycj3, and rps14 transcripts is not disrupted in Zmwhy1-1
and Zmwhyl-21-1 mutants (data not shown), suggesting that ZmWHYl is not required
for RNA editing.
ZmWHYl is required neither for chloroplast DNA replication nor for global plastid
transcription
The association of ZmWHYl with plastid DNA suggested that it might be
involved in chloroplast transcription or DNA replication. However, Southern blot
analysis of total leaf DNA showed that plastid DNA levels in ZmWhy1 mutants, although
somewhat variable from sample to sample, were generally similar to those in normal and
control mutant plants (Figure 8). In addition to the plastid transcripts shown in Figure 7,
a variety of other transcripts were examined by RNA gel blot hybridization
(Supplementary Figure 3A). In no case was a significant reduction in transcript level
detected, indicating that ZmWHYl is not necessary for global plastid transcription. In
fact, a trend is apparent toward increased transcript abundance in ZmWhy1 mutants, but
these changes are rather subtle and indirect effects on RNA abundance cannot be
excluded.
28
Figure 7. Accumulation of plastid RNAs in ZmWhy1 mutants.
Total seedling leaf RNA (5 ""g) was analyzed by RNA gel blot hybridization using probes
specific for the RNAs indicated at bottom. The rps12 probe was a cDNA probe
containing exons 1 and 2. The leafpigmentation conditioned by each mutant allele is
indicated: iv, ivory; pg, pale green. The methylene blue-stained blots are shown below,
with rRNAs marked. Additional RNAs that were analyzed analogously are shown in
Supplementary Figure 3A.
-
,
.....
C\lC}lC}I>;-
1 ............ 1
-~~~
kb ~ ~ Slll.e
'2:8:
6.0- .r"JiU·.....4.0" .;
3.0:" t.• '. ~•.'2.0 , ... _
1.5" .. , ..
1.0-
285-
185-
168- ,
235"- .•• ...; k._
rps12 eDNA
pg
rpl16ex2
Iv
-0.5
-mature
Ivpg
tmGmature
-
,
.....
C\lC}lC}I>;-
~~stttJ kb
-4.0
-3.0
-2.0
-1.5
-1.0.....
Iv
tmN
Ivpg
rps14
••
• ·1
Ivpg
IM"_..
petDex2
-
I
.....
C\lC\IC\I-~ ~ ~ i-i-~.~kb ~.c: 0 i i'i~
to.O_
8.0-
6.0- I_ ~ I
,- ~ lid 4'-'
4.0- ....... i".~ ~.,
3.0- ..
2.0-=....
1.5-.
1.0- .
0.5-
285-
185-
168-
235"- .
29
Figure 8. Chloroplast DNA levels in ZmWhy1 mutants.
Seedling leaf DNA (5 f!g) was digested with EcoRI (left), or Pvull (right) and analyzed
by DNA gel blot hybridization using a probe from the chloroplast rrn23 gene (top left),
or orf99 (top right). The same gels stained with ethidium bromide are shown below. The
small fluctuations in relative band intensity may result from small differences in sample
loading.
pg iv iv
iIIIIii.·················...- ~-~
'010-
WT
30
Recombinant ZmWHYl binds single-stranded RNA and DNA in vitro
To determine whether ZmWHY1 can directly bind both RNA and DNA,
recombinant ZmWHYl (rWHY1) was generated by expression as a maltose binding
protein (MBP) fusion. rWHYl was released from the MBP moiety by protease cleavage
and further purified on a gel filtration column (Figure 9A). rWHYl eluted from the sizing
column at a position corresponding to a globular protein of~100 kDa, consistent with the
report that StWHYl forms a homo-tetramer (28). Filter binding assays showed that
rWHYl binds to unspliced atpF RNA in vitro (Figure 9B), but it did not show specificity
for this RNA relative to other RNAs of similar size under the conditions tested (data not
shown).
To compare the affinity ofZmWHY1 for single-stranded and double-stranded
RNA and DNA, gel mobility shift assays were used to detect binding to a synthetic 31-
mer oligonucleotide in the context of single-stranded DNA, single-stranded RNA,
double-stranded DNA, or double-stranded RNA (Figure 9C). ZmWHYl bound rather
weakly to these short oligonucleotides but the results showed, nonetheless, that rWHYl
binds both ssDNA and ssRNA, and binds poorly to dsRNA and dsDNA.
31
Figure 9. Recombinant ZmWHYl binds single-stranded RNA and DNA.
(A) Elution of recombinant ZmWHYI from a gel filtration column. MBP-WHYI was
purified by amylose affinity chromatography, cleaved with TEV protease to separate the
WHYI and MBP moieties, and applied to a Superdex 200 column. Column fractions
were analyzed by SDS-PAGE and staining with Coomassie blue. The elution position of
size markers (alcohol dehydrogenase, 150 kDa; BSA, 67 kDa, MBP, 42 kDa) is shown.
The peak WHYI fractions were pooled and used for in vitro assays.
(B) Filter binding assay showing RNA binding activity ofZmWHYl. Assays containing
10 pM radiolabeled atpF intron RNA and increasing ZmWHY1 concentrations (50 nM
maximum) were filtered through sandwiched nitrocellulose and nylon membranes.
Protein/RNA complexes were captured on the nitrocellulose (bound); unbound RNA was
captured on the nylon membrane below.
(C) Gel mobility shift assay showing rWHYl 's relative affinity for double and single
stranded R1\fA and DNA. A 31-mer oligonucleotide in RNA or DNA form was
radiolabeled, heated, and either snap cooled (ssRNA, ssDNA), or cooled slowly in the
presence of monovalent salts and a two fold excess of its complement (dsRNA, dsDNA).
The substrate (40 pM) was mixed with increasing concentrations of ZmWHY1 (17,
50,150 nM). Protein binding is illustrated by the appearance of an upper band and
retention at the top of the gel, and by the disappearance of unbound substrate.
A
B
150kD 67kD 42kD
::!
frWHY1] 0 --===::::1~
Bound I 1.' t .,
Unbound ,... • • 'I
c
ssRNA dsRNA ssDNA dsDNA
IB
Iu
32
Discussion
Previous reports have attributed diverse functions and intracellular locations to
WHYl. WHY1 in dicots has been reported to be a single-stranded DNA binding protein
that functions in the nucleus as both a transcription factor (26, 28) and as a negative
regulator of telomere length (29). Arabidopsis WHY1 copurified with the
"transcriptionally active chromosome" from chloroplasts (31). Our results add another
layer to this complex picture. We demonstrate that ZmWHY1 is essential for chloroplast
biogenesis, and that it localizes to the chloroplast where it plays multiple roles in gene
expression. We also add RNA-binding to WHY1's repertoire of biochemical activities
and demonstrate that ZmWHY1 is bound to a subset of chloroplast RNAs in chloroplast
extract
Multiple roles of ZmWHYl in chloroplast biogenesis
ZmWHY was identified among proteins that coirnrnunoprecipitate with CRS1,
which is required for the splicing of the group II intron in the chloroplast atpF pre-
mRNA. We showed that ZmWHY1 is associated with atpF intron RNA in vivo and that
the coimmunoprecipitation of ZmWHY1 and CRS1 is disrupted by RNAse, indicating
that they coimmunoprecipitate due to their association with the same RNA molecule.
ZmWHY1's association with atpF RNA is functionally significant, as atpF intron
splicing is disrupted in ZmWhy1 mutants. However, the splicing of this intron is more
sensitive to a partial loss ofCRS1 than to a partial loss of ZmWHY1, suggesting that
ZmWHY1 plays an accessory function in atpF splicing but may not be absolutely
required.
The atpF splicing defect in Zm Why1 mutants cannot account for their loss of
plastid ribosomes, as the more severe atpF splicing defect in crs1-1 mutants is not
accompanied by a substantial plastid ribosome deficiency (20). The specific role of
ZmWHY1 in promoting the biogenesis of the plastid translation machinery remains
unclear. Although several RNAs with translation-related functions are among the RNAs
33
that coimmunoprecipitate with ZmWHY1, the abundance and processing of these RNAs
are similar in ZmWhyl mutants and in control mutants that exhibit a ribosome-deficiency
of similar severity. The specific rRNA deficiencies in ZmWhyl mutants do suggest,
however, that ZmWHYI is most directly involved in the biogenesis of the large
ribosomal subunit: the accumulation and processing of the 238 and 4.58 rRNAs are more
sensitive to the partial loss of ZmWhyl function than are those of 168 rRNA, whereas the
reverse is true for hej7 mutants. Furthermore, in ppr5 mutants, whose primary defect is in
the maturation of a specific plastid tRNA, the rRNAs from the two ribosomal subunits
are impacted to a similar extent (48). Thus, our results point to the biogenesis of the
plastid large ribosomal subunit as one function ofZmWHYI but definition of its precise
role in this process will require additional study. The strong defect in the processing step
that separates 238 rRNA from 4.58 rRNA in hypomorphic ZmWhyl mutants is
reminiscent of defects reported for mutations in the DeL, DAL, and RNRI genes in dicots
(54-57). Although it is unclear whether any of these genes functions directly in 238/4.58
rRNA processing, it is possible that WHYI acts in concert with one or more of these
proteins.
ZmWHYl binds both RNA and DNA in vitro and in vivo
We show here that chloroplast DNA coimmunoprecipitates with ZmWHYI from
plastid extract, that a fraction ofZmWHY1 is tethered to the thylakoid membrane in a
DNA-dependent fashion, that a fraction of stromal ZmWHYI is found in DNA-
containing particles of~400 kDa, and that Zm WHY1 binds single-stranded DNA in
vitro. These results are consistent with previous reports that dicot WHY1 binds single-
stranded DNA (28, 29) and that it copurifies with a chloroplast "transcriptionally-active
chromosome" (31). Our findings suggest that ZmWHY1 either binds DNA in a sequence
non-specific fashion or that it has many binding sites distributed throughout the plastid
genome, because DNA sequences from throughout the plastid genome
coimmunoprecipitated to a similar extent with ZmWHYl. It remains possible, however,
that ZmWHYI associates with specific DNA regions in vivo, but that these associations
34
were disrupted during lysate preparation. A DNA-immunoprecipitation experiment was
recently reported for AtWHY2, a mitochondrial-localized Whirly protein (32), with
analogous results: DNA sequences from a variety of regions throughout the
mitochondrial genome coimmunoprecipitated with AtWHY2, when assayed by peR.
We demonstrate here that ZmWHYl interacts not only with DNA, as anticipated
by previous reports, but that it also binds RNA in vivo and in vitro. That ZmWHYl
interacts with RNA is, perhaps, not surprising given that a structural homolog of
ZmWHYl has been shown to bind RNAs involved in kinetoplastid RNA editing (53),
and that many proteins that bind single-stranded DNA also bind RNA. The atpF intron
RNA was the major RNA ligand of ZmWHYl detected in the RNA
coimmunoprecipitation assays. This RNA is not particularly abundant in vivo so its
enrichment in ZmWHYl immunoprecipitations likely reflects a specific interaction in
vivo. Although intrinsic specificity for this RNA did not emerge from in vitro binding
assays using the entire intron, a high affinity site within a large RNA such as the atpF
intron (~800 nucleotides) can be masked in vitro due to the over-whelming number of
non-specific sites available for protein binding. Therefore, more detailed studies
involving smaller RNA ligands will be required to determine whether ZmWHYl binds
RNA with sequence-specificity, or whether it is recruited to the atpF intron via protein-
protein interactions.
What is WHYl's DNA-related function in the chloroplast?
The association of ZmyWHYl with DNA sequences from throughout the
chloroplast genome suggests that it participates in transcription and/or DNA metabolism.
However, our results argue against a general role in transcription, as all plastid mRNAs
examined accumulate in hypomorphic Zmwhy1 mutants to levels that are comparable to
those in the relevant control mutants. The results of chloroplast transcription run-on
experiments argue that the preferential loss of238 rRNA in these mutants is due to
aberrant ribosome assembly rather than to reduced rRNA transcription rates. It remains
35
possible, however, that ZmWHY1 does playa role in chloroplast transcription but that
another gene with a partially redundant function serves this purpose in ZmWhyl mutants.
It is intriguing that ZmWHY1 binds preferentially to DNA in single-stranded
form because opportunities to interact with single-stranded DNA in vivo are expected to
be limited. DNA replication, recombination and repair involve the transient occurrence of
single-stranded DNA, and torsional stress can induce DNA unwinding. The Southern blot
data showing that plastid DNA levels are no more than minimally decreased in ZmWhyl
null mutants argue against a central role for ZmWHY1 in DNA replication; however
participation ofZmWHY1 in DNA recombination or repair remains possible. In fact, the
participation of an unrelated ssDNA binding protein, OSB 1, in plant mitochondrial DNA
recombination was reported recently (58).
There are several parallels between our findings with ZmWHY1 and the activities
reported for the bacterial protein HU. HU is associated with the bacterial nucleoid, binds
preferentially to DNA with irregular structural features (e.g. single-stranded gaps and
bulges), and is involved in DNA recombination and repair (59,60). Despite its high
conservation in bacteria and the presence of an HU homolog in a plastid genome in red
algae (61), HU homologs are not encoded in the nuclear or plastid genomes of vascular
plants (61,62). Thus, alternative proteins have presumably been recruited in vascular
plants to fulfill the functions performed by HU in the chloroplast's cyanobacterial
ancestor. The nucleoid-associated protein sulfite reductase has been suggested to be one
such protein (62-64), and perhaps WHY1 is another. HU influences global transcription
patterns through its effect on nucleoid architecture, and mediates the formation of DNA
loops that repress transcription from specific genes (65-67). HU is also an RNA binding
protein, and functions in vivo to repress the translation of the E. coli rpoS mRNA (68,
69). Like HU, ZmWHY1 interacts globally with plastid DNA, but specifically with
certain plastid RNAs, and binds preferentially to nucleic acids with single-stranded
character. The abundance of several chloroplast mRNAs is increased in ZmWhyl
mutants, consistent with a global repressive role for ZmWHY1 in transcription. This
possibility is in accord with the recent report that over-expression ofAtWHY2 in
36
Arabidopsis causes a reduction in the levels of several mitochondrial RNAs (32).
Although its role in DNA metabolism remains uncertain, our results demonstrate that
description of WHYI as a chloroplast transcription factor is, at best, an over-
simplification of the complex roles played by this interesting protein.
Bridge
The preceding chapter discusses WHYl, a plant specific RNA and DNA binding
protein in the Whirly protein family. The severe phenotype of WHY] mutant plants
suggests this protein is crucial for chloroplast biogenesis, however the mechanism of
WHYls function is still not understood. The following chapter will discuss the
pentatricopeptide repeat (PPR) family, another family of proteins important for organelle
biogenesis. Like WHY 1, PPR proteins are sequence-specific binders of RNA, and are
indispensable for chloroplast function. Both Whirly family members and PPR family
member are targeted to either the chloroplasts or the mitochondria. Whereas Whirly
proteins comprise a small, plant specific family (2 to 3 members per species), PPR
proteins are found in all eukaryotes, and the family is extremely large in plants,
consisting of more then 450 members in angiosperms (11). The data presented here gives
insight into how this diverse family of proteins may function to regulate chloroplast and
mitochondrial gene expression.
37
CHAPTER III
BIOCHEMICAL ANALYSES SUGGEST THAT PPRIRNA INTERACTIONS
INVOLVE AN UNUSUAL RNAIPROTEIN INTERFACE THAT IS SUFFICIENT
TO MEDIATE A VARIETY OF POSTTRANSCRIPTIONAL EFFECTS
This chapter describes analyses of two members of the pentatricopeptide repeat
protein family, PPRlO and PPR5. This work was done in collaboration with Dr. Alice
Barkan, Margarita Rojas, and Orner Ali Bayraktar. Margarita Rojas performed the
structure probing assays and some of the partial alkali hydrolysis binding assays, and
Orner Ali Bayraktar performed the PPRI0 partial alkali hydrolysis binding assay with 5'
end labeled RNA.
Introduction
Mitochondria and chloroplasts contain small genomes that reflect their origins as
free-living bacteria. The organellar genomes are much reduced in comparison to those in
their bacterial ancestors, and their gene expression mechanisms have diverged
considerably. For example, genes in chloroplasts are transcribed by two different types of
RNA polymerase, and the transcripts are then subject to an array of processing events
that include RNA editing, group I and group II intron splicing, and the processing of
polycistronic precursors to yield monocistronic mRNAs. These events are carried out by
nucleus-encoded proteins, most of which are innovations that evolved in the eukaryotic
host.
38
The pentatricopeptide repeat (PPR) family is a notable example of a host-derived
protein family that mediates gene expression in chloroplasts and mitochondria (reviewed
in 70). PPR proteins consist of up to ~25 degenerate repeats of a 35 amino acid sequence,
usually in a single tandem array (10). They are found in all eukaryotes but form a
greatly expanded family in plants, with more then 450 members in angiosperms (11). The
PPR motif shares homology with the TPR motif, a helical hairpin motif found in repeated
arrays that mediates protein-protein interactions. However, genetic data have consistently
implicated PPR proteins in functions related to RNA metabolism; these include RNA
editing, RNA splicing, RNA cleavage, RNA stabilization, and translational control
(reviewed in 70). Biochemical analyses of several PPR proteins support the notion that
they exert downstream effects through site-specific binding to RNA (71-73). However,
the mechanistic basis of the diverse activities attributed to PPR proteins is largely
unexplored.
To elucidate how PPR proteins recognize specific RNA sequences and mediate
their effects on RNA metabolism, we are studying several PPRIRNA interactions in
detail. We describe here in vitro analyses of two chloroplast PPR proteins, PPR5 and
PPRI0, whose physiological functions and in vivo binding sites were reported previously.
PPR5 binds within a group II intron found in a chloroplast tRNA precursor (trnG-UCC),
protecting it from inactivation by an endonucleolytic cleavage (48, 71). PPRI0, in
contrast, binds in the intergenic regions of two polycistronic transcripts and stabilizes
adjacent RNA segments. That PPRI0 binding sites are found at the immediate 5' or 3'
ends of those RNAs it stabilizes suggested that PPRI0 serves as a barrier to
exonucleolytic RNA degradation in vivo (72).
Results presented here provide evidence that PPRlO is sufficient to block RNA
degradation by both 3'7 5' and 5'73' exoribonucleases in vitro. In addition, we define
the minimal RNA segments required for a high affinity interaction with PPR5 and
PPRlO, and probe the effects of these interactions on adjacent RNA structures. The
results support the notion that PPR5 and PPRlO bind an extended stretch of single-
stranded RNA, and that this binding disrupts RNA structures that would otherwise inhibit
39
splicing and translation, respectively. These findings suggest plausible mechanisms
underlying the ability ofPPR10 to enhance atpH translation (72) and PPR5 to enhance
tmG-UCC splicing in vivo (48). This study shows how two seemingly disparate functions
of PPR proteins, translational activation and promotion of splicing, can be explained as a
passive consequence of the ability of a PPR tract to bind in a sequence-specific fashion to
an extended segment of single-stranded RNA. We speculate that most or all of the
functions attributed to proteins comprised purely of PPR repeats may result from their
intrinsic ability to block access to the RNA by other proteins and to remodel RNA
structures.
Materials and Methods
Ribonucleic acid binding assays
Gel mobility shift (GMS) assays were performed as previously described (71).
Briefly, in vitro transcribed RNAs (oligonucleotides 3,4,5,8, and 9 in the PPR5 assays) or
synthetic RNAs (all PPR10 oligonucleotides and oligonucleotides 1,2,6, and 7 used for
PPR5 GMS assays) were 5'-end labeled with [y-32P]-ATP. PPRlO binding reactions
contained 100 mM NaCI, 40 mM Tris pH 7.5, 4 mM DTT, 0.1 mg/ml BSA, 0.5 mg/ml
heparin, 10% glycerol, 10 units RNAsin, ~40 pM radiolabeled RNA, and protein
concentrations as indicated. The PPR10 stoichiometric binding assay was performed as
for the PPR10 GMS assays, except that it included 100 nM RNA (~40 pM radiolabeled,
the rest was unlabeled)(19 nt sequence shown in Figure 1) and increasing concentrations
of protein as indicated. PPR5 binding reactions contained 100mM NaCI, 1 mg/ml
heparin, 40 mM Tris pH 7.5, 4 mM DTT, .04 mg/ml BSA, 10% glycerol, 10 units
.RNAsin, ~40 pM radiolabeled RNA, and protein concentrations as indicated. All
reactions were incubated for 20 min at 25°C and resolved on 5% native polyacrylamide
gels.
40
Minimal binding assay using partially alkali hydrolyzed RNA
10 pmols of5' or 3' end label RNA oligonucleotide (55nt trnG intron RNA for
PPR5 and 49 nt atpH 5' UTR RNA for PPRlO) were ethanol precipitated and
resuspended in alkaline hydrolysis buffer (50mM Na2C03 pH9.5 and ImM EDTA). The
RNA was distributed in 5 different tubes and boil for 1,2,3,4 and 5 min respectively, and
then snap cooled on ice for 1 min. The RNA was purified by phenol: chloroform
extraction, and ethanol precipitation. The hydrolyzed RNA was incubated in the absence
or presence of recombinant protein at 20°C for 20 min under the following buffer
conditions: 30mM Tris pH7.5, 100mM NaCl, 4mM DTT, 0.04mg/ml BSA, and 500ng/lll
of heparin (25 ng/Ill heparin for PPRI0). Binding reactions were separated on a 5%
native polyacrylamide gel in Ix THE buffer as previously described (71). The set of
bands corresponding to the bound and unbound fractions were excided, eluted in RNA
elution buffer (0.5M NH40AC, 0.25% SDS, ImM EDTA), extracted with phenol:
chloroform, and precipitated with Ethanol. Samples were resuspended in 20lll formamide
loading dye and analyzed on an 8% polyacrylamide gel in lXTBE as previously
described (71).
PNPase purification
His tagged Synechocystis polynucleotide phosphorylase (PNPase) expression
construct in pET-20b (+) vector was generously provided by the Shuster lab. PNPase was
expressed in BL21 star E.coli cells. Induction and lysis via sonication were preformed as
described in Williams-Carrier et al. (2008) except that lysis buffer consisted of 50 mM
NaH2P04 pH 8, 300 mM NaCl, 20 mM imidazole, 10% glycerol, 1% Tween-20, and 2
mM BME. The lysate was cleared by centrifugation at 13,000 g for 20 min. Cleared
lysate was bound to 1 ml Ni-NTA agarose (Qiagen) and incubated for 1 h at 4°C. Slurry
was put on .8X4 em Poly-Prep Chromatograph Column (Bio-Rad). Column was washed
3 times with 5 ml of lysis buffer. Protein was eluted with 1 mllysis buffer containing 100
mM imidazole, followed by 2 mllysis buffer containing 250 mM imidazole. Elute was
brought up to 15.5 ml volume with Q buffer (20 mM HEPES pH8, 50 mM NaCI, 12.5
41
mM MgCl, .1 mM EDTA, 2 mM DTT). Elute was then added to 1 ml Q Sepharose, Fast
Flow (Amersham Biosciences). Slurry was incubated for 1 h at 4°C and put on .8X4 cm
Poly-Prep Chromatograph Column (Bio-Rad). Column was washed 3 times with 5 ml of
Q buffer. Protein was eluted through a series of 1 ml washes with Q buffer containing
increasing concentrations ofNaCl: 150 mM, 300 mM, 450 mM, and 600 mM. Protein
eluted at ~300mMNaCl. Buffered glycerol (~100% glycerol with Q buffer constituents)
was added to a final concentration of 19%. Protein aliquots were taken and stored at -
20°C for use, and -80°C for long-term storage.
In vitro exonuclease protection assays
PNPase assays for 3'~5' exonuclease activity. Synthetic RNA oligonucleotide
corresponding to the atpH 5' UTR (sequence in Figure 3A) was 5'-end labeled with [y-
32P]-ATP and gel purified as for the gel mobility shift assays (71). ~80 pM radiolabeled
RNA was heated 2 min at 90°C, removed from heat, and snap cooled on ice. Salt mix
was added to final concentration of25 !-tg/ml Heparin, 30 mM Tris pH 7.5, 100mM NaCl,
4 mM DTT. 5 !-tl PPRIO was added to PPRIO + samples, final concentration 100 nM.
PPRIO dialysis buffer was added to PPRIO - samples. Final sample volume was 25 !-tl.
Samples were incubated 15 min at 25°C. 2!-tl PNPase was added to PNPase + samples,
final concentration 440 nM. PNPase buffer (Q buffer with 19% glycerol) was added to
PNPase - samples. Samples were incubated at 25°C for 20 min. 10 !-tl of each sample was
run on a 5% native gel as in the gel mobility shift assays (71). Remaining sample was
phenol extracted and ethanol precipitated. RNA pellets were resuspended in 15 !-tl
formamide die mix boiled 3 min and applied to a 30 cm long, 8% polyacrylamide, 8M
urea, IX TBE (89 mM Tris pH 8.3,89 mM boric acid, 2 mM EDTA), denaturing gel.
Gels were run at 20 W (constant power) at room temperature until the bromophenol blue
dye migrated to ~8 cm from the bottom of the gel.
Terminator exonuclease assays for 5'~3' exonuclease activity. Synthetic RNA
oligonucleotide corresponding to the atpH 5' UTR (sequence in Figure 3A) was 3'-end
labeled by annealing with a DNA sequence complementary to the last (3 ') 20 nt and
42
beginning with an additional 5' G. Klenow polymerase lacking the exonuclease domain
was used to incorporate an [a-32P]-CTP. The product was gel purified as for the gel
mobility shift assays (71). ~80 pM radiolabeled RNA was heated 2 min at 90°C, removed
from heat, and snap cooled on ice. Salt mix was added to final concentration of 25 !!g/ml
Heparin, 50 mM Tris pH 8, 100mM NaCl, 2 mM MgCh, 4 mM DTT. 5 !!l PPRI0 was
added to PPRI0 + samples, final concentration 100 nM. PPRI0 dialysis buffer was added
to PPR10 - samples. Final sample volume was 25 !!l. Samples were incubated 15 min at
25°C. 2!!1 Terminator 5'-73' exonuclease (Epicentre Biotechnologies) was added to
Terminator + samples, final concentration 100 nM. Samples were incubated at 25°C for
20 min. 10 !!l of each sample was run on a 5% native gel as in the gel mobility shift
assays (71). Remaining sample was phenol extracted and ethanol precipitated. RNA
pellets were resuspended in 15 !!l formamide die mix boiled 3 min and applied to a 30 cm
long, 8% polyacrylamide, 8M urea, IX TBE (89 mM Tris pH 8.3,89 mM boric acid, 2
mM EDTA), denaturing gel. Gels were run at 20 W (constant power) at room
temperature until the bromophenol blue dye migrated to ~8 cm from the bottom of the
gel.
Nuclease cleavage structure probing assays
5-end labeled trnG 55mer RNA oligonucleotide (O.lpmols) in the absence or
presence of rPPR5 protein was incubated at 20°C for 20 min under the following buffer
conditions 30mM Tris pH7.5, 100mM NaCl, 4mM DTT, 0.04mg/ml BSA, and 100ng/!!1
of heparin. The binding step was followed by cleavage with varying concentrations of
either RNAseTI (Ambion) or RNAse VI (Ambion) or Mung Bean Nuclease (NEB) or
Rnase H (Ambion) at 20°C for 10 min. Treated RNA was added to 10!!1 of formamide
loading dye. Samples were analyzed on either and 15% or an 8% polyacrylamide, 8M
urea gels. A limited alkaline digestion oftmG55 mer was added for size comparison. The
gel was dried and exposed to a PhosphoImager screen, and ImageQuant software was
used to view and analyzed the gel data.
43
2-Aminopurine fluorescence assay
RNA containing 2-aminopurine in place of adenine at the indicated position
(Dharmacon RNA Technologies)(Fig 6) was diluted to 500 nM in binding buffer (lOO
mM NaCl, 50 mM NaP04 pH 7.5, 100 !!g/ml heparin, 3 mM ~ME). All reactions were
performed at room temperature, in binding buffer, using a I-formate Jobin-Yvon Horiba
Fluoromax fluorimeter and a 3 mm wide Spectrosil microcell cuvette (Stama Cells, Inc).
Readings were taken without PPR5 added, and with indicated concentrations ofPPR5
(5X was 2.5 !!M PPR5, lOX was 5 !!M PPR5) at 4 time points, immediately after
addition ofPPR5 (~30sec), 5 min, 10 min, and 15 min after addition ofPPR5. The 2-
aminopurine was excited at 315 nm, and spectra were collected from 320 to 420 nm. The
fluorimeter slits were 2 nm, with an integration time of 0.1 seconds. Spectra collected
with buffer, protein, and RNA without 2-aminopurine incorporated was used to subtract
out background. The value at 370 nm was used to calculate relative fluorescence.
Results
The minimal PPRI0 binding site spans 15 nucleotides
Previously we had localized a high affinity PPR10 binding site to a 29-nt segment
of the atpH 5'-UTR (72). To better define the minimal region required to bind PPRlO
with high affinity, we assayed its boundaries by performing binding assays with end-
labeled RNA harboring the binding site that had been subjected to partial alkaline
hydrolysis; the length of the shortest labeled RNAs capable of binding PPRlO defines the
distance from the labeled end that is required for a high-affinity interaction. The results
are shown in Figure lA and summarized in Figure IC. Analysis of 5' end-labeled RNA
placed the 3' boundary required for high affinity PPRI0 binding at position -29, with
respect to the start of the atpH ORF. Analysis of 3' end-labeled RNA placed the 5'
boundary at roughly - 42, although RNAs with several additional nucleotides at the 5'
end bind preferentially.
44
To validate and extend these conclusions, several synthetic RNAs were used in
gel mobility shift assays (Figure IB). An 18 nt RNA that lackes one nucleotide ofthe 3'
boundary defined above failed to interact with PPRI 0, whereas all RNAs that include all
the sequence within the 3' and 5' boundaries resulted in a high affinity interaction.
Additional binding assays need to be done using synthetic RNA with the exact
boundaries defined above to validate that these boundaries truly define the minimal
ligand. 11114 of the nucleotides in the minimal atpHbinding site, as defined by the alkali
hydrolysis binding assays described above, are shared in PPRIO's second binding site,
found in the psaJ-rpl33 intergenic region. This striking conservation strongly suggests
that most or all of the nucleotides within this RNA segment contribute to its specific
interaction with PPRlO.
The elution profile of recombinant PPRIO from a gel filtration column suggested
that it might be a homodimer (72). To further address this possibility, we performed a
stoichiometric binding assay in which the RNA was present at a concentration well above
the~, and the fraction of RNA bound to protein was measured as a function ofPPRlO
concentration (Figure 2). The results show an inflection point at a PPRlO:RNA ratio of
~2.5. This finding is consistent with the possibility that PPRlO binds RNA as a
homodimer, although we cannot exclude the possibility that the high stoichiometry
results from a population of inactive PPRlO molecules.
PPRIO protects its RNA ligand from 3' and 5' exonucleolytic cleavage in vitro
We showed previously that the PPRlO binding sites are found at the 5' or 3'-
termini of those chloroplast RNAs that fail to accumulate inpprlO mutants (72). On that
basis, we hypothesized that bound PPRlO blocks 3' and 5' exonucleases, thereby
stabilizing adjacent RNA segments. To test whether bound PPRlO is sufficient to
45
Figure 1: The PPRIO RNA ligand.
(A) Mapping the boundaries of sequences required for a high-affinity interaction with
PPRIO. The RNA shown in (C) was labeled at either its 5' or 3' end, subjected to partial
alkali hydrolysis and used for gel mobility shift assays with PPRIO. RNA was extracted
separately from the gel regions containing unbound and bound RNA, and resolved on a
denaturing polyacrylamide gel. The nucleotides assigned to each band were inferred
based on their position from the labeled end. T- total hydrolyzed RNA. U- RNA that did
not bind PPRIO. B- RNA that bound PPRIO.
(B) Gel mobility shift assays, using the synthetic RNAs diagrammed in panel (C).
(C) Summary of data that define the minimal PPRIO binding site. The sequence of the
synthetic RNA used for the boundary mapping experiment is shown at top; arrows
annotate the major RNA termini defined by PPRIO in vivo, and asterisks annotate
nucleotides conserved between the PPRlO binding sites in the atpH 5' UTR and the psaJ
3'UTR. The smallest end-labeled RNAs that bound well to PPRIO are indicated with
bars; the 5' boundary is indicated with a dashed line, because of the gradient in apparent
affinity observed as additional nucleotides in this region are included (see panel A, 3' end
label). Smaller synthetic RNAs used for the gel mobility shift assays in panel Bare
shown below, annotated according to the degree to which they interact with PPRIO.
AB
T
5' end label
B TB U
B01U1d
Free
46
29nt 22nt
[PPRIO]uM 0 3 II 33100 =
free I
C !ltPH S' UTR
19nt
=
25nt
=
18nt
-7
_
_..:.:.=======--------------3' lahel5' label
******** ***** ****** * * ***
5'UUGAUUGUAUCCUUAACCAUUUCUUUUUUUUUGACACGAGGAACUCAUCAUG3'
+ ++ ~
a1P.H 5' in vivo-end qJpj 3' in vivo-ends
UGAUUGUAUCCUUAACCAUUUCUUUUUUU
UGUAUCCUUAACCAUUUCUUUUUUU
GAUUGUAUCCUUAACCAUUUCU
GAUUGUAUCCUUAACCAU
UGUAUCCUUAACCAUUUCU
29nt
25nt
22nt
lSnt
19nt
Binding
++
++
+
++
47
block exonucleolytic RNA degradation in vitro, we performed in vitro assays with
recombinant PPRlO, synthetic end-labeled RNAs, and purified exonucleases (Figure 3).
The Synechocystis polynucleotide phosphorylase (PNPase) was used as the 3'~5'
exonuclease, as it is more easily expressed as a recombinant protein than is its chloroplast
ortholog. Whereas the 5'-end labeled RNA alone was quickly degraded by PNPase, the
addition ofPPRI0 inhibited degradation. (Figure 3B). The 3' termini that were stabilized
Figure 2: Stoichiometric binding assay with recombinant PPRlO. Gel mobility shift
assays were performed with a 5' end labeled synthetic 19 nt atpH 5' UTR RNA (Figure 1
C) at 100 nM concentration (Data not shown). The results were quantified by
phosphorimaging. Linear trendlines were created in Excel using either the first 5 data
points or the last 4 data points.
/ .
.../t
/
.~~
1
"=
0.8
a
= 0.6
=
=
=:= 0.4u
CIS
t.
'- 0.2
o
o 1 234 5
(PPR10]/(RNA ligand]
6 7
by PPRI0 in this assay map ~10 nts downstream of the most abundant termini found in
vivo (Figure 3A). There are several possibilities that can account for this. First, PNPase-
mediated polyadenylation is believed to enhance processive RNA degradation through
RNA secondary structures, but the reaction conditions used here were not optimized for
polyadenylation activity. Second, PNPase is not the only 3'~ 5' exonuclease in
48
Figure 3: PPRIO protects against 3' and 5' exonuclease activity in vitro.
(A) Diagram of the RNA ligand used for nuclease-protection assays. The bar denotes the
3' ends that were protected from the PNPase assay shown in panel B.
(B) PPRIO protects RNA from Synechocystis PNPase in vitro. The left panel shows a gel
mobility shift assay with the indicated proteins and the 5' end labeled RNA. The right
panel shows a denaturing gel of the RNA recovered from the same reactions. The bar
marks the termini ofRNAs that were protected from PNPase digestion by PPRlO. PPRlO
and PNPase concentrations are 200 nM and 440 nM respectively.
(C) PPRIO protects RNA from a 5'-.73' exonuclease. Terminator exonuclease (Epicentre
Biotechnologies) and PPRlO were included in reactions with 3'-end labeled RNA, as
indicated. The left panel shows a native gel mobility shift assay. The right panel shows a
denaturing gel of the RNA recovered from the same reactions. PPRIO and terminator
exonuclease concentrations are 200 nM and I !AM respectively.
A
B
atpH5' UTR
awH 5' in vivo-end (l!Il13' ill vivo-ends
+ ~+ -++ t *
S'UUGAUUGUAUCCUUAACCAUUUCUUUUUUUUUGACACGAGGAACUCAUCAUG3'
start
c
~++-- ++
PPRIO + - + - + - + -
...
Native gel Denaturing gel
Tenninator + +
PPRIO + +
Native gel
+ + -
+ - +
Denaturing gel
49
chloroplasts (reviewed in 7); thus, a different exonuclease could cooperate with the
PNPase to generate the in vivo 3' end. Despite these caveats, these results suggest that
bound PPRI0 is sufficient to confer protection from 3' -7 5' exonuclease digestion.
However, I plan to repeat this assay with chloroplast extract, using the conditions
reported for efficient native PNPase activity (74).
The same RNA was labeled at its 3' end and incubated with a commercially
available 5'-73' exonuclease. The addition ofPPRI0 fully protected the RNA from
degradation (Figure 3C), indicating that bound PPRI 0 is sufficient to block access by
5'-73' exonucleases. Because the PPRI0 binding site is near the 5' end of this RNA
substrate, it is possible that bound PPRI0 simply prevents the exonuclease from loading
onto the RNA instead of blocking exonucleolytic progression. To address this possibility,
I will repeat this assay with an RNA that has additional sequence upstream of the PPRI0
binding site.
PPRIO binding releases the atpH ribosome binding site from a sequestering
secondary structure
Previously we had shown that the residual atpH mRNAs in ppr10 mutants are
translated less efficiently than their counterparts in normal plants, indicating that PPRI 0
binding simultaneously stabilizes atpHRNA and enhances its translation (72). In light of
this observation, it is intriguing that the putative Shine-Dalgamo element for atpH
translation is predicted to base pair with a portion of the PPRI0 binding site (Figure 4A).
Current data support the view that PPR tracts bind single-stranded but not double-
stranded nucleic acids along their surface (71, 75, 76). Thus, we hypothesized that
PPRlO's interaction with the "anti-Shine-Dalgamo" element would prevent masking of
the Shine-Dalgamo region, thereby facilitating ribosome recruitment.
To test this hypothesis we used ribonucleases 1'1 and Yl to probe the structure of
the atpH 5' UTR in the presence and absence ofPPRI0 (Figure 4B). RNAse 1'1 cleaves
after guanosines, but only when they are in a single-stranded context; RNAse VI cleaves
50
Figure 4: PPRIO binding induces structural changes in the atpH 5'UTR.
(A) Predicted structure of the atpH 5' UTR and summary of the structure probing data.
The lowest energy structure predicted by M-Fold is shown. The "in vivo" footprint of
PPRIO (flanked by the predominant 5' and 3' ends ofPPRIO-dependent termini in vivo)
is shaded. The atpH start codon and putative Shine-Dalgarno (SD) element are marked.
PPRIO-induced changes to cleavage by RNAses TI and VI are marked by (+) and (-), to
indicate increased or decreased cleavage in the presence ofPPRIO, respectively.
(B) Structure probing assay of the atpH 5' UTR with (+), and without (-) PPRIO. The
RNA diagrammed in (A) was radiolabeled at its 5' end and subjected to partial alkali
hydrolysis (OR marker), denaturation and digestion by RNAse TI (TI marker), or
incubation with RNase TI or VI under conditions that permit RNA folding.
(C) Proposed mechanism by which PPRIO binding induces atpHtranslation.
A
c
PPRIOQ PPRlOSite~~~
-.L ('
~0V
B
-+
b ..~~8 8
T1 V1 =-
_+ _+ + _ + 0 f-o PPRlO
51
regions in which the bases are stacked due to their presence in a double-stranded region
or to other structural constraints. In the absence ofPPRI0, the three guanosine residues in
the putative Shine-Dalgamo element were not cleaved by RNAse 1'1, and the anti-Shine-
Dalgamo element was efficiently cleaved by RNAse VI. These results support the
existence of the predicted RNA duplex in the majority of molecules. Addition ofPPRlO
caused a dramatic change in the digestion pattem. First, the guanosines within and a short
distance upstream of, the Shine-Dalgamo element were now efficiently digested by
RNAse 1'1, indicating a substantial increase in their single-stranded character. Second,
RNAse VI ceased to cleave the anti-Shine-Dalgamo region; this could be due either to
direct protection by PPRI0 or to a PPRI0-induced loss of the RNA duplex. Finally,
PPRlO binding increased RNAse VI sensitivity at several positions 3' to the PPRI0
binding site. PPRI0 apparently induces the stacking of these bases, but details of these
changes cannot be inferred from these data. It is intriguing, however, that a similar
enhancement ofRNAse VI cleavage was observed adjacent to RNA bound by PPR5 (see
below).
These data show that PPRI0 binding induces a rearrangement of the RNA in the
atpH 5' UTR. The PPRI0-induced rearrangement would be anticipated to enhance
translation regardless of whether the putative Shine-Dalgamo site indeed has ribosome
binding activity, as initiating ribosomes interact with ~30 nucleotides of single-stranded
RNA centered on the start codon (77). Taken together, these results support a model in
which PPRI 0 captures its binding site in the atpH 5'UTR in single-stranded form,
thereby increasing the single-stranded character of the atpH ribosome binding region and
facilitating ribosome binding (Figure 4C).
The PPR5 binding site is complex and includes discontinuous RNA segments
To understand general features ofPPRIRNA interactions, it is necessary to
analyze multiple examples. Thus, a second PPR protein, PPR5, was analyzed in parallel
with PPRI0. Previously we had determined that the PPR5 binding site resides within a
50 nt segment ofthe group II intron in pre-trnG-UCC (71). When PPR5 binds to this site
52
in vivo, it stabilizes the unspliced precursor by blocking an endonucleolytic cleavage
(48). In addition, PPR5 appears to enhance splicing itself, as the ratio of spliced-to-
unspliced trnG RNA is substantially reduced in hypomorphic ppr5 mutants. A direct role
for PPR5 in splicing is consistent with the fact that its binding site contains several
sequence elements that are important for group II intron splicing: Exon Binding Site I
(EBS I), a', and {) (see Figure 5A). In order for splicing to occur, each ofthese sites must
pair with complementary sequences found elsewhere (lBS 1, a, and {)', respectively)
(reviewed in 78). The EBS 1 and {) elements in this intron are unusual, in that they are
predicted to be sequestered in a stable RNA hairpin (Figure 5A); formation of this
structure is supported by the ribonuclease-sensitivity data described below. Thus, we
hypothesized that PPR5 binding may enhance splicing by influencing the structure of this
RNA (71).
To understand how PPR5 could influence the splicing of its group II intron ligand,
we initially defined its binding site more precisely by using assays analogous to those
described above for PPRIO. The PPR5 analysis was more complex than that ofPPRlO
for two reasons. First, previous data suggested that PPR5 interacts with discontinuous
RNA segments ((71), and this possibility was supported by the additional results
described below. Second, the RNA sequence harboring the PPR5 binding site has the
capacity to form several alternative structures, with the favored structure changing as
various segments are removed (data not shown). Because PPR5 binds preferentially and
possibly solely to single stranded RNA (71), failure ofa deletion construct to bind to
PPR5 could potentially be due to sequestration ofPPR5 recognition elements within an
RNA duplex.
When a partial alkali hydrolysis binding assay with 5' end-labeled RNA was
preformed, the shortest RNA that bound with high affinity to PPR5 terminated two
nucleotides into the a' element, suggesting that recognition determinants for PPR5 lie
within or just upstream ofa' (see 10 3' boundary in Figures 5A and B). Although
binding was lost for molecules ending in the single-stranded region upstream ofa' (gray
bar in Figure 5B), weak binding was detected after further truncation to remove the base
53
Figure 5: Mapping the boundaries of sequences required for a high-affinity interaction
withPPR5.
(A) Predicted secondary structure of the region harboring the PPR5 binding site.
Elements involved in group II intron splicing (EBS I, (), and a') are marked. The
boundaries mapped in the experiments shown in (B) are indicated.
(B) Partial alkali hydrolysis binding assay, using 5' or 3'-end labeled RNA. The
nucleotides assigned to each band were inferred based on their position from the labeled
end and by comparison to a nuclease Tlladder. T- total hydrolyzed RJ\fA. U- RNA that
did not bind PPR5. B- RNA that bound PPR5.
20 5'
boundary
10 5'
boundary
TUB
3' end label
1
20 3'
boundaries
TUB
5' end label
B
10 3'
boundary
3' ",
C
'\
9, "
a,·c ~u -u -u ~.f~gf.;
A EBSt
'~.7";""")a \q;<'i
;.uJ~.1 20 5' boundary
~-q 20 3'
u ···a
~ -~ boundaries
I I
~-~
~-'i
u-a
I I
boundary a, -~' > '.
~ c-g-c-a.a" .......9 -.....~.a/ 'u~\a '\'a u .~
f I;
a a·
5' I \ .;•...u;I
" .I
a"
54
of the 3' side ofthe hairpin as these molecules were depleted from the unbound fraction,
and enriched in the bound fraction (see 20 3' boundary in Figure 5A and B). Therefore,
PPR5 can interact with molecules that end within the distal side of the stem, albeit with
lower affinity than with the full-length 50-mer. That deletion of the distal side of the stem
was required to reveal this secondary interaction suggested that sequences on the 5' side
of the stem are important for PPR5 binding, and that these are masked when the stem is
intact.
A partial alkali hydrolysis binding assay with 3'-end labeled RNA revealed that
truncation of the 5' end past position 3 reduced binding dramatically (see 10 5' boundary
in Figure 5 A and B). Thus, these boundary mapping experiments implicated sequences
both 5' and 3' to the stem as being important for PPR5 recognition, consistent with gel
mobility shift data reported previously (71).
Gel mobility shift assays with synthetic oligonucleotides (Figure 6) confirmed
that RNA sequences on both sides of the hairpin are required for a high-affinity
interaction with PPR5. For example, removing the four adenine residues at the 5' end
caused a dramatic decrease in binding (Figure 6B, construct 2), as did deletion of five
nucleotides within the 3' single-stranded region (Figure 6B, construct 9). To determine
whether sequences within the stem contribute to binding affinity, various stem
truncations were assayed. Previously we showed that deletion of the EBS1 element did
not disrupt binding (71). An RNA lacking the distal half of the stem (construct 5)
maintained considerable binding activity. This RNA apparently adopts two structures that
migrate differently through a native gel (see asterisks); only the more slowly migrating
conformer bound PPR5, as only this form was depleted as PPR5 concentrations
increased. That a high affinity interaction with PPR5 requires some invasion of the stem
was suggested by the fact that stabilizing the truncated stem with a terminal tetraloop
decreased its interaction (compare constructs 4 and 5). Furthermore, removal of the
entire stem eliminated binding (Figure 6B, construct 6), strongly suggesting that
recognition determinants reside within the stem itself. Indeed, the
55
Figure 6: The PPR5 RNA ligand.
(A) Alignment of the PPR5 ligand region and truncations used for gel mobility shift
assays. Exon Binding Site 1 (EBS1), delta (6) and alpha prime (a') are labeled. Predicted
stem denoted by parenthesis. Sequence 4 contains a tetraloop (UUCG) that promotes
stem formation. PPR5 binding affinity indicated by ++ (high affinity), + (moderate), and
- (no binding).
(B) Gel mobility shift assays showing PPR5 binding to the truncations of the trnG RNA
shown in A). Sequence 5 apparently adopts two conformations that migrate differently in
the gel (*).
(C) Diagram ofthe region of the tmG intron to which PPR5 binds. Lines indicate which
part of the RNA molecule was removed or altered (in the case of 8) resulting in the
constructs in A). Sequences that were bound by PPR5 are labeled in gray whereas
sequences that did not bind are labeled in black. EBS 1, 6, and a' are in gray boxes.
++
++
+
++
Binding
++
a'
a EBSl
------«( «« «« )))) )))))))
5'AAAAAACGAUGGUUUUGGUUUACUAGAACCAUCAGUAUAUUAUAUUGUUUCAGCU3'1
AACGAUGGUUUUGGUUUACUAGAACCAUCAGUAUAUUAUAUUGUUUCAGCU 2
GGAACGAUGGUUUUGGUUUACUAGAACCAUCAGUAUAUUAUAUUGUUUCAGCU 3
GGAACGAUGGU---------UUCG----------ACCAUCAGUAUAUUAUAUUGUUUCAGCU 4
GGAACGAUGGU----------------------------ACCAUCAGUAUAUUAUAUUGUUUCAGCU 5
AAAAAACG-------------------------------------------------CAGUAUAUUAUAUUGUUUCAGCU 6
CAUCAGUAUAUUAUAUUGUUUCAGCU 7
GGAACGAUGGUUUUGGUUUACUAGAACCAUCAGUAUAUUAUAUUCAAACAGCU 8
GGAACGAUGGUUUUGGUUUACUAGAACCAUCAGU----------AUAUUGUUUCAGCU 9
A
B
tnmcated stem c
6
~
u
I
~-~
u-a
--.:-=t- 4&5
I I
~-'i~-T7
u-a
I I
~6
......-c-.g-C-Q ......
2 "'.,a/a 9"a.~ u
,. 8\
a u
~ A9 ~
5'; ~
I
54
76 1
[PPR5] oM 0 200 400 0 2550 100
--------------" --_._---
56
boundary-mapping data using 5' end labeled RNA revealed a 2° interaction site upon
removal of the 3' end of the stem (see above), implicating nucleotides near the 5' end of
the stem as contributing to PPR5 binding.
Previously, we had reported that elimination of sequences downstream ofa'
prevents the binding ofPPR5 (71). In this study we found that a GUUU to CAAA
substitution just downstream ofa' greatly increases PPR5 binding (Figure 6B, construct
8). These data suggest that PPR5 may be interacting with sequences 3' of the a' site as
well as sequences 5' of this site.
Taken together, these results support the view that PPR5 recognizes nucleotides
that are discontinuous in the primary sequence; these include the 5' single-stranded
region, one or several nucleotides on the 5' side of the stem base, the single-stranded
region on the 3' side of the stem adjacent to a', and perhaps nucleotides on the 3' side of
a'. That deletion of the entire stem eliminates binding is an important observation, as this
provides evidence that PPR5 invades the stem, providing a plausible mechanism by
which it could influence the stability of the hairpin, and thus the efficiency of splicing. It
will therefore be important to firmly establish the location of PPR5 recognition
determinants at the base of the RNA stem. To test the notion that the nucleotides on the
5' side of the stem contribute to a high affinity interaction with PPR5, I plan to test
several additional constructs. For example, I will test the binding activity of an RNA
harboring nucleotides 1-11, fused directly to nucleotides 33 through 50.
PPR5-induced changes in RNA structure suggest mechanisms by which PPR5
enhances splicing
Group II intron splicing requires the EBS 1, a', and () elements within the intron to
base pair with their complements found elsewhere. Consequently, these elements are
found in a single stranded context in the vast majority of group II introns (reviewed in
78). In this context, the apparent sequestration ofEBSI and () in the PPR5 binding region
within the trnG-UCC intron (Figure 5) are striking. The binding data suggested that PPR5
might destabilize this hairpin (and thereby activate splicing) by invading the 5' side of the
57
stem. To address how PPR5 influences the structure of its RNA ligand, we used
ribonucleases Tl, VI and Rl to probe RNA structure in the presence and absence of
PPR5 (Figure 7). RNAse Tl cleaves after single-stranded guanosines, RNAse Rl cleaves
single-stranded pyrimidines, and RNAse VI cleaves stacked or double-stranded regions.
The results obtained in the absence ofPPR5 (Figure 7A) provided support for the
predicted stem-loop structure. For example, RNAses Rl and Tl cleaved the region
between the predicted stem and a', but did not cleave within the predicted stem (lanes 5-
8 and 13-16). RNase VI, in contrast, cleaved many of the positions predicted to reside
within the stem (lanes 9-12). The EBS 1 was cleaved weakly by RNAse Rl (lanes 13 and
14), but not at all by RNAse Vl(lanes 9-12).
When PPR5 was bound to the RNA prior to the ribonuclease treatments, the
cleavage patterns changed in several interesting ways. For example, the single-stranded
region upstream ofa' became less sensitive to cleavage by RNAse Rl (lane 14),
suggesting an interaction between PPR5 and these nucleotides (see dark gray bar in
Figure 7). Indeed, deletion of nucleotides in this region caused a dramatic decrease in
PPR5 binding (see construct 9 in Figure 6). The G residue at the 5' base of the stem
became susceptible to cleavage by RNAses Tl and Rl (see G* lanes 5-8 and 13-16 in
Figure 7), suggesting that PPR5 binding releases this nucleotide from an RNA duplex.
The most dramatic effect, however, concerned the a' region, which became
hypersensitive to all three nucleases upon PPR5 binding (lanes 5-16). Enhanced cleavage
by RNAses Tl and Rl suggested an increase in single-stranded character, yet the
increased sensitivity to RNAse VI indicated increased base-stacking or base-pairing.
These observations suggested that PPR5 binding constrains the structure ofthe RNA in
the a' region, such that the bases are single-stranded but stacked. Curiously, however,
the a' residues whose RNAse Tl sensitivity increased upon PPR5 binding are not
adjacent to G residues, and were not susceptible to RNAse Tl cleavage even in the fully
denatured RNA (see Tl marker, lane 1, in Figure 7). A profound change in the structure
of these nucleotides is further supported by the fact that the G residue within a' site
becomes sensitive to RNAse H cleavage in the presence ofPPR5 (lanes 17 and 18), yet
58
Figure 7: Ribonuclease sensitivity assay of RNA structure in the absence and presence of
PPR5.
(A) The RNA shown in panel B was labeled at its 5' end, incubated in the absence (-) or
presence (+) ofPPR5, and then treated with RNAse TI, VI, or Rl. Two concentrations
of each nuclease were tested, with the left pair of lanes in each instance representing the
higher concentration. The TI marker was generated by treating the same RNA with
RNAse TI after heating and snap-cooling to minimize secondary structures. The OR
marker is a partial alkali hydrolysis, to mark the positions of consecutive nucleotides.
PPR5 incubated under the same conditions used for the nuclease treatment did not cause
any RNA cleavage (lane 4). G* refers to a residue that becomes susceptible to RNAse
TI and RNAse RI after PPR5 binding. Other features referred to in the text are coded
with bars to the right, and summarized in panel B.
(B) Summary of structure probing data. EBS I and a' sites are outlined and indicated by
black bars in (A). G* residue that becomes susceptible to RNAses TI and RI with PPR5
addition is encircled. Stem structure is shaded gray and indicated by gray bars in (A).
Region that is protected from RNAse RI cleavage when PPR5 is added is outlined and
shaded gray, and indicated by a dark gray bar in (A).
A
... ...
0) 0)
11
..... 0;::f-<o
- +
TI
- + - +
VI
- + - +
R1
- + - + PPRS
"..
"Cl;
&.g B
RNaseH
- +
30
59
60
RNAse H is believed to be specific for RNA found in the context of an RNAIDNA
hybrid. Taken together, these results show that PPR5 binding causes the u' site to
become hypersensitive to nucleases, including nucleases that would not ordinarily
recognize those particular sequences. These observations suggest that PPR5 changes the
architecture ofthis region of the RNA in an unusual way, and that this might be
important for presenting the u' element during the splicing reaction.
The nuclease-sensitivity data offered hints that PPR5 binding may reduce the
double-stranded character ofEBS1 and its flanking sequences. As noted above, the G
residue at the 5' end of the stem becomes susceptible to RNAse 1'1 cleavage upon PPR5
.binding. In addition, a subtle but reproducible enhancement of RNase R1 cleavage of
EBS1 sequences is induced by PPR5 (Figure 7, bar labeled EBS1). To gain further
insight into this possibility, the formation of the stem was probed by substituting a
fluorescent analog of adenine, 2-aminopurine (2-AP), for one of the adenines on the
distal side of the stem (Figure 8A). 2-AP fluorescence is high when it is unstacked but
greatly decreases when it is stacked due to its residing in an RNA duplex or other
structural constraints (79). Addition ofPPR5 to the 2-AP modified RNA resulted in an
increase of fluorescence, indicative of reduced base stacking in the stem (Figure 8B).
PPR10, which does not bind with high affinity to the PPR5 binding site, also induced
some increase in fluorescence, although to a much lesser extent. This is consistent with
the fact that PPR10 binds weakly to this RNA under the reaction conditions used (data
not shown). Initially, the enhanced fluorescence caused by PPR5 in comparison with
PPR10 increased with time. This could be due to different binding kinetics, or could be a
result of nucleases in the PPR5 preparation. I plan on resolving these possibilities at a
.
later date by isolating the RNA directly after determining the fluorescence and assaying
for degradation.
These uncertainties not withstanding, the body of nuclease-sensitivity and 2-AP
fluorescence data support the idea that PPR5 binding results in an increase in the single-
stranded character of the RNA duplex harboring EBS1 and o. As PPR5 binds to single
stranded but not double stranded RNA (71) and clearly requires nucleotides within the
61
stem for a high-affinity interaction (Figure 6, construct 6), a reasonable hypothesis is that
PPR5 binding nucleates in the single-stranded regions flanking the stem, but ultimately
invades the stem base. This may enhance the splicing of the tmG intron, by increasing the
accessibility of the EBS 1 and C elements to their RNA partners.
Figure 8: PPR5 causes an increase in 2-aminopurine fluorescence in its ligand, indicating
unfolding of the RNA stem.
(A) The tmG RNA ligand of PPR5 with Exon Binding Site One (EBS1), C, and the
position of 2-aminopurine labeled.
(B) fluorescence emission at 370nm for RNA [.5[.lM] mixed with PPR5 or PPRlO.
Readings were taken either right away, or after 5, 10, and 15 minutes.
•
•
•
•
•• ~t ..
t~
• PPR5 5min • PPR5 10mill
x PPRI0 5min + PPRlO lOmin
[PPR5 or PPRIO] IlM
5 6
• PPR5 1501in
"PPRIO 15min
432
15
o
+PPR5
XPPRIO
B
35
.-...
0
0 300
-><
'-'
§
250r-
M
~
d
0
"til 20
'"
"s
u.l
A
62
Discussion
In this study we have defined the PPRlO and PPR5 binding sites to high
resolution, and we showed that both proteins profoundly influence the structures adopted
by the RNA flanking their binding sites. These results have broad implications regarding
mechanisms by which PPR proteins recognize RNA and influence downstream functions.
PPR proteins have been implicated in a variety of processes, including RNA splicing,
RNA editing, RNA cleavage, RNA stabilization, and translation control. Because these
functions appear to be diverse, it has often been suggested that PPR proteins serve as
adaptors to recruit various effector proteins to specific RNA sites. However, with the
notable exception ofPPR proteins involved in RNA editing, experimental evidence to
support this view is lacking. Our results suggest an alternative possibility: that most
functions attributed to PPR proteins- particularly those consisting largely of "pure" PPR
repeats - result as a passive consequence of their sequence-specific binding to long tracts
of single-stranded RNA. Below we discuss evidence that the PPRIRNA interaction
interface is unusually long in comparison with those mediated by most RNA binding
motifs, and that this activity in itself could account for many of the dramatic and diverse
effects ofPPR proteins on organellar RNA metabolism.
Features of the PPRIO binding site suggest that PPRIO binds RNA along an
unusually long RNA/protein interface
Several observations support the idea that PPRlO's RNA interaction surface is
substantially longer than that of typical RNA binding proteins. Most RNA binding
proteins contain several globular RNA binding domains, such as the RRM or KH
domain, each ofwhich contacts ~2-5 nucleotides. The combinatorial action of several
domains and their variable orientation with respect to one another can mediate the
recognition of specific RNAs based on a combination of sequence and structure (80-82).
In contrast, the minimal RNA segment required for a high affinity interaction with PPRI0
spans ~15 nt, with its in vivo footprint (i.e. the RNA protected by PPRI0 from
63
exonucleases in vivo), substantially larger, at ~25 nt. The extremely high conservation of
the nucleotides within this RNA segment provides evidence that most of its nucleotides
contribute to binding affinity. Thus, PPRlO's second binding site, which maps in the
psaJ-rp133 intergenic region, has only three nucleotide differences, and even these small
differences are associated with a substantial decrease in binding affinity (72).
Furthermore, the sequence of the 25 nts within PPRIOs in vivo footprint in the atpH 5'
UTR is almost identical in monocot and dicot plants (e.g. maize and spinach differ at
only one of25 positions). Although no other PPR proteins have been analyzed in this
level of detail, several compelling observations support the view that the PPR protein
HeF152 likewise has an extensive in vivo footprint and that its binding site is extremely
highly conserved between monocots and dicots (72). These data, albeit still limited,
suggest that an extensive RNA/protein interface along which most contiguous nucleotides
interact with the protein is the norm for PPR proteins harboring long tracts ofcanonical
PPR repeats.
That long PPR tracts have an extensive RNA interaction surface is consistent with
structural predictions. The PPR motif is closely related to the TPR motif, a 34 amino acid
repeating unit that generally mediates protein-protein interactions (10, 83). TPR tracts
adopt a helical repeat solenoid structure (83-85), with each repeat forming a pair of
helices, and consecutive repeats stacking to form a broad substrate-binding surface. It is
anticipated that PPR tracts likewise form helical repeat solenoids, although structural data
remain very limited (71). This is an atypical structure for a nucleic acid binding protein,
but there is precedent in the PUM-Homology Domain (PUM-HD). The PUM-HD defines
the "PDF" protein family, whose members regulate gene expression in eukaryotes by
binding specific 3' UTRs and influencing RNA stability or translation (reviewed in 86).
Structural analyses revealed an unusual mechanism for RNA recognition: the PUM-HD
consists of eight helical repeating units; consecutive repeats stack to form an RNA
binding surface, with each repeat recognizing a single RNA base (87). Our results
support the view that PPR tracts likewise bind single-stranded RNA parallel to the axis of
stacked alpha helices. Whereas the PUM-HD always consists of eight repeats and binds
64
an ~8 nt core element, the number of repeats in PPR proteins is highly variable and
generally greater, with 20 repeats commonly observed. Thus, according to this model of
PPRIRNA recognition, the length of the PPRIRNA interaction surface is limited only by
the number ofPPR motifs.
PPRlO contains 16 canonical PPR motifs that are preceded by two additional
repeats that have more TPR character (72). That PPRlO's minimal RNA ligand spans 14-
16 nt is intriguing in light of its 16 PPR motifs, as it suggests that each nucleotide may be
recognized by a single PPR motif. However, prior observations suggested that
recombinant PPR10 forms homodimers (72), and the stoichiometric-binding assay
presented here supports this view, in that two molecules ofPPRlO appear to bind to each
atpH 5'UTR. One possible explanation for this apparent discrepancy is that one monomer
binds in a sequence-specific manner to the minimal binding site whereas the other binds
to adjacent regions in a sequence-non-specific fashion. This view is consistent with the
finding that PPRlO's in vivo footprint is significantly longer than its minimal binding site.
The PPR5/RNA interaction is considerably more complex, and therefore is less
informative regarding the relationship between the number of PPR motifs and the number
ofnuc1eotides recognized. PPR5 recognizes two non-contiguous RNA segments within a
50-nt RNA sequence, and this RNA has a propensity to fold into various stable RNA
structures. Our results indicate that PPR5 can bind to either the 5' or 3' portion of the 50-
mer, but that it binds with highest affinity when both regions are present in the same
molecule. In aggregate, our results lead us to favor a model in which two molecules of
PPR5 bind to each 50-mer, one interacting with the 5' single-stranded region and
invading the RNA duplex, the other interacting in the single-stranded region between the
duplex and alpha'. We further speculate that two PPR5 monomers bind to this RNA
cooperatively, as recombinant PPR5 did not dimerize, and gel mobility shift assays did
not provide evidence for complexes ofvarying mobility as the PPR5 concentration was
increased (71). Additional experiments will be required to fully understand these
interactions.
65
Site-specific barrier and RNA remodeling functions ofPPR5 and PPRIO:
implications for the mechanisms by which PPR proteins mediate downstream effects
Genetic data have implicated proteins composed virtually entirely ofPPR motifs
in diverse functions, including RNA cleavage, RNA stabilization, translational control
and group II intron splicing. Thus, it has often been thought that they serve as sequence-
specific adapters whose sole function is to recruit effecter proteins to appropriate RNA
sites. Our findings with PPR5 and PPRI0 suggest an alternative view: that the unusual
features of the PPRIRNA interface can directly result in most or all of the in vivo
functions attributed to "pure" PPR proteins (i.e. those composed almost entirely of
canonical PPR motifs) without the involvement of accessory factors. We propose that: (i)
long PPR tracts sequester an extended segment of single-stranded RNA; (ii) that this
activity makes them particularly effective at blocking access to their RNA ligands by
other proteins and at remodeling adjacent RNA structures; and (iii) that these two effects
are sufficient to account for the many biological functions attributed to proteins of this
nature.
Our results with PPR5 and PPRI0 illustrate how a pure PPR protein can, on its
own, enhance the splicing, translation, or stability of specific RNAs, and can appear to
enhance site-specific RNA processing events. We showed previously that PPRI0 is
required for the accumulation of those RNAs harboring its binding site at either their 5'
or 3' end, suggesting that PPRI0 serves as a barrier to exonucleases intruding from either
direction (72). Here we present evidence that PPRIO is sufficient to block
exoribonucleases in vitro. Additional genetic data support the idea that a blockade to 5'-7
3' degradation is a common function ofPPR proteins (e.g.88). Recently, a moss PPR
protein was shown to stabilize its RNA ligand against 3' -7 5' exonucleases in vitro (89).
Finally, PPR5 stabilizes the trnG-UCC precursor in vivo against an inactivating
endonucleolytic cleavage (48, 71). Together, these results strongly suggest that the ability
to block ribonuclease access to its RNA ligand is an intrinsic activity of long PPR tracts.
Genetic data have provided evidence that some PPR proteins repress the translation of
specific organellar mRNAs. This activity can likewise be accounted for by a passive
66
"barrier" activity, as an extensive interaction with an RNA segment that includes
nucleotides required for interaction with initiating ribosomes would surely inhibit
translation initiation.
In addition to blocking access of bound RNA to other proteins, it is anticipated
that an interaction with a long PPR tract will likewise block interaction of an RNA
segment with complementary RNA sequences. This, in turn, can influence RNA folding
in a manner that can account for the ability of pure PPR proteins to activate translation,
splicing, and even RNA cleavage. Results presented here for PPR5 and PPRI 0 provide
evidence for this type ofRNA remodeling activity. PPRIO binding enhances the
translation of the adjacent atpH open reading frame in vivo. The PPRlO binding site
includes sequences that are complementary to the putative Shine-Dalgamo element for
atpH translation. We show here that PPRI0 binding releases the Shine-Dalgamo element
from sequestration in an RNA duplex, providing a plausible mechanism to explain its
translation enhancing effects. An analogous mechanism can account for genetic data
suggesting a translation activating function for other PPR proteins, with no need to
invoke active recruitment of components of the translation machinery.
PPR5 is one of several PPR proteins that have been shown to enhance the splicing
of group II introns in vivo. We believe the mechanism by which PPR5 promotes tmG
intron splicing mirrors the mechanism by which PPRIO promotes translation. PPR5 binds
RNA that is adjacent to the critical splicing elements EBS 1, (), and a', which need to base
pair with their complementary sequences for splicing to occur. Without PPR5, EBS 1 and
() are sequestered in a stem loop structure, and the presence of PPR5 destabilizes this
structure. We propose that the PPR5 binding site includes several nucleotides at the base
of the stem loop, and that PPR5 binding promotes the unfolding of the stem by capturing
its RNA ligand in a single stranded conformation. In addition, PPR5 induces an unusual
spectrum of nuclease hypersensitivity within the a' sequence: PPR5 binding enhances
cleavage by both single-strand and double-strand "specific" ribonucleases (RNAses TI
and VI), by RNAse H in the absence of an RNA/DNA duplex, and by RNAse TI at
residues other than guanosines, its normal substrate. These results suggest that PPR5
67
distorts the RNA in close proximity to its binding site, possibly in a manner that makes
a' more accessible for pairing with its a complement.
In summary, the ability ofPPR5 and PPRlO to influence the structure adopted by
adjacent RNA segments can explain their ability to activity translation and splicing,
respectively. An analogous mechanism may account not only for other instances in which
pure PPR proteins enhance the translation or splicing of specific RNAs, but also for the
ability of some PPR proteins to enhance endonucleolytic processing at specific sites. For
example, the binding of a PPR protein to an intergenic region on a polycistronic RNA
could influence the adjacent RNA structure, and thereby expose a segment ofRNA with
features that make it susceptible to cleavage by generic endonucleases. We proposed
previousy that RNases E and J are primarily responsible for the endonucleolyic cleavage
events that initiate both RNA processing and RNA decay in chloroplasts. The bacterial
orthologs of these enzymes cleave AU-rich RA segments found in an unstructured
context. Thus, a PPR binding site that includes an AU rich RNA segment can be
anticipated to stabilize nearby RNA, whereas a PPR binding site adjacent to an AU rich
RNA segment could enhance its accessibility to these nucleases by minimizing local
RNA structure.
Our model that many functions attributed to PPR proteins are a passive
consequence of the unusually extensive protein/RNA interface that is predicted for these
proteins is limited to those PPR proteins that lack additional domains. In fact, many PPR
proteins in plants include one of the accessory domains denoted as E, E+, or DYW. These
proteins are involved in RNA editing, an activity that certainly requires a catalytic
activity. Furthermore, the PPR tracts in such proteins are variants of the regular repeating
array of tandem PPR motifs found in proteins such as PPR5 and PPRIO; this variant
organization, designated "PLS", is likely to interact with RNA in a less regular way,
possibly of a "looser" nature. Although a recruitment function need not be invoked to
explain most of the genetic data obtained for pure PPR proteins, our model does not
preclude the possibility that some pure PPR proteins do interact with other proteins;
indeed the homodimerization ofPPRlO provides evidence for a protein-protein
•68
interaction surface on this protein.
Genetic analysis has identified many PPR proteins that have diverse functions
related to RNA binding. We believe that many of these functions may be mediated by the
PPR proteins ability to promote single-stranded RNA conformation through, and adjacent
to, its binding site. Biochemical approaches that identify the specific binding sites of
these proteins, and analysis of these sites, will be essential in determining how prevalent
this model for PPR protein function is.
69
CHAPTER IV
CONCLUSIONS AND FUTURE DIRECTIONS
Conclusions
This dissertation investigates the nuclear control of gene expression in the
chloroplast. The plant nucleus encodes many families of proteins that are targeted to the
chloroplast where they regulate expression of the chloroplast genome. Some of these
proteins are descendent from cyanobacterial proteins that may have had similar function
prior to endosymbiosis. Many of these proteins are host innovations that evolved to
accommodate the needs of a changing chloroplast genome. The proteins discussed here,
WHYl, PPR5, and PPRlO, are examples of the latter group of host-derived proteins.
Chapter II discusses WHYl, a chloroplast targeted, nuclear encoded protein that
binds to both single-stranded DNA and single-stranded RNA. WHYl binds with
specificity to the atpF group II intron and promotes atpF splicing. However, why1 mutant
plants show a strong albino phenotype that cannot be accounted for by this splicing defect
alone. Examination ofwhy1 mutant transcripts revealed a severe loss of 23S and 4.5S
ribosomal RNAs suggesting that WHYI is involved in the biogenesis of the large
ribosomal subunit. WHYI does not appear to bind directly to ribosomal RNAs, or mature
ribosomes, leading us to conclude that WHY1's influence on ribosomal biogenesis is
most likely indirect.
WHYI also binds DNA throughout the chloroplast genome and has a strong
preference for single-stranded DNA. Though other groups have proposed functions for
WHYI binding to DNA in the nucleus (26, 27 , 29), the significance ofthis property in
the chloroplast still remains to be elucidated. WHYl does not appear to be involved in
-----~ ----
70
nucleoid DNA replication or global transcription as chloroplast transcript and DNA
abundance in why] mutants is similar to that ofrelevant controls. WHYl
coimunoprecipitates all chloroplast DNA sequences suggesting the WHYllDNA
interaction is not sequence-specific, although the possibility that WHY 1 binds with
sequence-specificity to a sequence represented throughout the entire chloroplast genome
cannot be excluded.
Chapter III discusses the PPR family ofproteins. PPR proteins are involved in
many diverse RNA-related functions. However, most PPR proteins lack obvious catalytic
domains. Because of this, they are often proposed to be sequence-specific adaptors that
recruit effecter proteins to appropriate RNA sites. We have shown here, that the unique
PPRIRNA interaction surface can directly explain many of the functions attributed to
PPR proteins. The results presented in this dissertation provide three examples: RNA
stabilization, translational activation, and RNA splicing.
The previously accepted model of RNA processing in the chloroplast suggested
that mature RNA termini are defined by site-specific endonucleolytic cleavage of
polysistronic transcripts (7). According to this model, sequence-specific RNA binding
proteins, like PPR proteins, define mature RNA ends by recruiting endonucleases to
specific cleavage sites. Data presented here, as well as in our previous investigations,
suggest an alternative model in which PPR proteins define mature RNA termini by acting
as a site-specific barrier to exonucleolytic cleavage (72). In this model endonucleases
cleave polysistronic transcripts at exposed (ribosome free) AU rich regions. Exonucleases
subsequently degrade the RNA from the cleavage site until their progression is blocked
by secondary structure or bound proteins like PPRl O. This hypothesis obviates the
necessity for PPR protein-protein interaction sites, which are vital to the recruitment-
based model. In vitro exonuclease assays support this model by demonstrating that
recombinant PPRlO can block both 3' ~ 5' and 5' ~ 3' exonuclease progression.
Another consequence ofPPRlO binding is increased translation ofatpHRNA.
We had previously shown that PPRlO promotes translation of atpH mRNAs, although the
mechanism was unclear (72). In this study we elucidate this mechanism. We demonstrate
71
that PPRlO promotes the formation of single-stranded RNA encompassing the ribosome-
binding region of the atpH transcript. In the absence ofPPRlO, the Shine-Dalgamo
sequence, which is important for ribosomal recruitment, is base paired with part ofthe
PPRI0 binding site. We propose that this structure limits ribosomal access to the 5'UTR
thereby inhibiting translation. The PPRlO/RNA binding site includes the complement
sequence to the Shine-Dalgamo site, therefore PPRI0 binding prevents formation of this
inhibitory srtucture. This exposes the Shine-Dalgamo and promotes ribosomal
recruitment. This model for promoting translation does not rely on PPR protein-protein
interactions, but instead rests solely on PPRI Os ability to bind a long RNA tract and
thereby prevent its base pairing with adjacent sequences.
We believe the mechanism by which PPR5 promotes tmG intron splicing mirrors
the mechanism by which PPRlO promotes translation. Similar to the case for PPRlO,
PPR5 binds a stretch ofRNA that is adjacent to sequence elements required for splicing:
EBSl, tJ, and a' (71). All three need to base pair with their complementary sequences for
splicing to occur. Without PPR5 present, EBSl, and tJ are sequestered in a stem loop
structure. We propose that PPR5 captures the stem loop sequence in a single-stranded
conformation thereby enabling the EBS 1, and tJ elements to base pair with their
complementary sequences. In addition, PPR5 induces nuclease hypersensitivity in the a'
sequence suggesting that it augments the structure of this RNA in some way. The
significance of this is not clear but it could reflect a conformational change that makes a'
more accessible for base pairing.
We show here that both PPRIO and PPR5 can prevent secondary structure
formation by binding single-stranded RNA. We demonstrate how this property results in
two disparate PPR functions, ribosomal recruitment in the case of PPRI 0, and splicing in
the case of PPR5. In both cases, the downstream effect can be explained by PPR proteins
binding to an extended tract of single-stranded RNA, and thereby influencing the
structure of adjacent RNA, instead of directly recruiting effecter proteins. We speculate
that this mechanism of action may be common among many PPR proteins.
72
Future Directions
Future directions related to WHY!
Despite the many functions that have been attributed to WHYI and the other
whirly family members, there is no clear indication how this family ofproteins mediates
their downstream effects. The WHY I phenotype in maize presents as a seedling with
virtually no chlorophyll, suggesting chloroplast biogenesis is severely affected. This
phenotype can be explained by the near complete loss of ribosomal RNA from the
chloroplast. However, how the why] mutation leads to rRNA loss is still a mystery that
needs to be resolved. We did not find evidence for a direct interaction between WHYI
and ribosomal RNA or ribosomal subunits, but we cannot exclude that WHYl may
influence ribosomal assembly factors. (not really- just brings down the whole nucleoid... )
It is still unresolved whether WHYl binds to DNA without specificity, or whether
it binds a commonly represented sequence. Co-crystallizing WHYl with DNA would
address this issue. The significance of WHY1's DNA binding properties in the
chloroplast has yet to be revealed. Though we found no gross defects in DNA amount or
nucleoid appearance in why] mutant plants, a closer analysis of nucleoid composition and
structure could reveal defects suggestive ofWHYl function.
Finally, how WHYl contributes to atpF intron splicing warrants further
investigation. Refinement of the WHYI binding site within the atpF intron could give
insight into this question.
Immediate directions related to PPR proteins
Several experiments need to be done to clarify aspects of the work presented in
this dissertation. The PPRI 0 minimal binding site, as determined by alkali hydrolysis
binding assays, needs to be validated by GMS assays. We plan to determine whether
PPRIO will bind a synthetic RJ'JA oligonucleotide that recapitulates the minimal 3' and 5'
ends. The ~15 nt PPRlO binding site is of a manageable size for in depth mutagenesis
studies. We will make mutations in this sequence and assay for PPRlO binding ability.
73
This can give us insight into which, and how many, bases are important for PPRI 0
interaction. In addition, deleting internal nucleotides can indicate whether PPRIO binds
as a ridged structure or whether it has a more flexible binding capacity.
We plan to perform additional exonuclease assays to refine our current findings.
We will repeat the PNPase assay under conditions that are more favorable for PNPase
activity. This may lead to a stronger correlation between the in vivo atpI 3' end, and the
3' end resulting from PPRIO protection against PNPase cleavage. Our results of the
5'~3' terminator nuclease assays could have two explanations: PPRIO blocks terminator
nuclease progression, or PPRIO prevents terminator nuclease from binding the RNA. To
distinguish between these two possibilities we need to repeat this assay with RNA that
contains additional 5' end sequence. This way we can be confident that terminator
nuclease loading is unhindered by bound PPRI O.
Long-term directions related to PPR proteins
Despite the prevalence and importance for pentatricopeptide repeat proteins in
plant organelles, there is relatively little known about the biochemical mechanisms
through which they exert downstream effects. This work explores how the putative long
RNA interaction surface can mediate several of the functions attributed to PPR proteins.
This investigation is one of the few biochemical analyses of this extensive family of
proteins. To better understand how PPR proteins mediate downstream affects it will be
important to carry out similar analyses with additional members of this protein family. In
this way we can determine whether the results presented here are exceptions to the rule,
or widely relevant to PPR family members.
PPR5 and PPRIO are the only proteins in this family for which there has been an
extensive analysis of the RNA ligand. Identifying and refining additional PPR ligands
will allow us to validate several of the predictions made by this study. Our research
predicts that many PPR proteins will have similarly long RNA binding sites. It will be
interesting to see whether the length of the RNA ligand typically correlates with the
number ofPPR motifs contained within the protein. Narrowing down the exact binding
74
sites, and modeling the RNA structures around these sites will provide insight into how
specific PPR proteins may influence gene expression. The PPR proteins we have studied
mediate downstream affects by promoting the formation of single-stranded RNA. It will
be interesting to see whether PPR proteins generally prefer single-stranded RNA as a
binding substrate, and if so, whether they tend to bind to sites where secondary structure
sequesters sequences important for RNA processing or translation.
Bioinformatic approaches can be used to identify potential PPR binding sites.
Many PPR proteins are predicted to bind to intergenic regions of the chloroplast genome.
Intergenic regions, in general, have low sequence conservation between plant species.
Because PPR proteins bind long RNA tracts with sequence-specificity we predict that
PPR binding sites in the intergenic regions will have a higher level of conservation then
adjacent sequences. We are currently working with a collaborator, Rodger Voelker, to
identify highly conserved sequences within intergenic regions of the chloroplast genome.
We believe some of these could correspond to PPR binding sites.
It is still unclear how PPR proteins recognize their RNA ligands. Because PPR
motifs are similar to TPR motifs, PPR sequences have been modeled by threading onto
known TPR structures. Such models allow us to speculate on what types of interactions
are possible between the PPR surface and nucleic acids. These models suggest that PPR
proteins may contain asparagine ladders similar to those in ARM repeat proteins.
Whereas in ARM repeat proteins these are thought to mediate nonspecific interactions
with other proteins, perhaps in PPR proteins they mediate interactions with RNA. Actual
crystallographic structures would greatly enhance our understanding ofPPRIRNA
interactions. Attempts at crystallizing PPRI 0 with and without its RNA ligand are
ongoing with our collaborators, Ian Small and Charles Bond.
The long interaction surface created by the consecutive arrangement of PPR
repeats suggests a modular nucleotide interaction motif that can be rearranged to create
new binding surfaces specific to new RNA sequences. Perhaps the expanded use ofPPR
protein in plants arose through gene duplication followed by simple rearrangements or
mutations of these repeats. The rearrangements may have resulted in specificity for new
RNA sequences, which were subsequently selected for based on utility. Further
understanding of PPR/RNA interactions could enable us to exploit these modules to
create de novo site-specific RNA interacting proteins.
75
76
REFERENCES
1. Timmis lJ'J, Ayliffe MA, Huang CY, & Martin W (2004) Endosymbiotic gene
transfer: organelle genomes forge eukaryotic chromosomes. Nat Rev Genet
5(2): 123-135.
2. Kleine T, Maier UG, & Leister D (2008) DNA Transfer From Organelles to the
Nucleus: The Idiosyncratic Genetics ofEndosymbiosis. Annu Rev Plant BioI.
3. Embley TM & Martin W (2006) Eukaryotic evolution, changes and challenges.
Nature 440(7084):623-630.
4. Allen JF (2003) The function of genomes in bioenergetic organelles. Philos Trans
R Soc Lond B BioI Sci 358(1429):19-37; discussion 37-18.
5. Maier VG, et al. (2008) Complex chloroplast RNA metabolism: just debugging
the genetic programme? BMC BioI 6:36.
6. Schmitz-Linneweber C & Barkan A (2007) RNA splicing and RNA editing in
chloroplasts. Cell and Molecular Biology ofPlastids, Topics in Current Genetics,
ed R B (Springer, Berlin / Heidelberg), Vol 19, pp 213-248.
7. Bollenbach T, Schuster G, Portnoy V, & Stem D (2007) Processing, degradation,
and polyadenylation of chloroplast transcripts. Cell and Molecular Biology of
Plastids, Topics in Current Genetics, ed Bock R (Springer-Verlag, Berlin), pp
175-211.
8. Kroeger T, Watkins K, Friso G, Wijk Kv, & Barkan A (2009) A plant-specific
RNA binding domain revealed through analysis of chloroplast group II intron
splicing. Proc Natl Acad Sci USA 106:4537-4542.
9. Barkan A, et al. (2007) The CRM domain: an RNA binding module derived from
an ancient ribosome-associated protein. RNA 13:55-64.
10. Small I & Peeters N (2000) The PPR motif - a TPR-related motifprevalent in
plant organellar proteins. Trends Biochem Sci 25:46-47.
11. Lurin C, et al. (2004) Genome-wide analysis ofArabidopsis pentatricopeptide
repeat proteins reveals their essential role in organelle biogenesis. Plant Cell
16(8):2089-2103.
77
12. Marchfe1der A & Binder S (2004) Plastid and plant mitochondrial RNA
processing and RNA stability. Molecular Biology and Biotechnology ofPlant
Organelles, eds Daniell H & Chase C (Kluwer Academic Publishers, Dordrecht,
The Netherlands), pp 261-294.
13. Nicke1sen J (2003) Chloroplast RNA-binding proteins. Curr Genet 43(6):392-
399.
14. Schwacke R, Fischer K, Ketelsen B, Krupinska K, & Krause K (2007)
Comparative survey of plastid and mitochondrial targeting properties of
transcription factors in Arabidopsis and rice. Mol Genet Genomics 277(6):631-
646.
15. Jenkins B, Kulhanek D, & Barkan A (1997) Nuclear mutations that block group II
RNA splicing in maize chloroplasts reveal several intron classes with distinct
requirements for splicing factors. Plant Cell 9:283-296.
16. Jenkins B & Barkan A (2001) Recruitment of a peptidy1-tRNA hydrolase as a
facilitator of group II intron splicing in chloroplasts. EMBO J 20:872-879.
17. Asakura Y & Barkan A (2007) A CRM domain protein functions dually in group
I and group II intron splicing in land plant chloroplasts. Plant Cell 19:3864-3875.
18. Asakura Y & Barkan A (2006) Arabidopsis Orthologs of Maize Chloroplast
Splicing Factors Promote Splicing of Orthologous and Species-specific Group II
Introns. Plant PhysioI142:1656-1663.
19. Ostheimer G, et al. (2003) Group II intron splicing factors derived by
diversification of an ancient RNA binding module. EMBO J 22:3919-3929.
20. Till B, Schmitz-Linneweber C, Williams-Carrier R, & Barkan A (2001) CRS1 is a
novel group II intron splicing factor that was derived from a domain of ancient
origin. RNA 7:1227-1238.
21. Watkins K. et al. (2007) A ribonuclease III domain protein functions in group II
intron splicing in maize chloroplasts. Plant Cell 19:2606-2623.
22. Asakura Y, Bayraktar 0, & Barkan A (2008) Two CRM protein subfamilies
cooperate in the splicing of group lIB introns in chloroplasts. RNA 14:2319-2332.
23. Falcon de Longevialle A, et al. (2008) The pentatricopeptide repeat gene OTP51
with two LAGLIDADG motifs is required for the cis-splicing of plastid ycD
intron 2 in Arabidopsis thaliana. Plant J. 56:157-168.
78
24. Schmitz-Linneweber C, et al. (2006) A Pentatricopeptide Repeat Protein
Facilitates the trans-Splicing of the Maize Chloroplast rps12 Pre-mRNA. Plant
Cell 18(10):2650-2663.
25. Ostersetzer 0, Watkins K, Cooke A, & Barkan A (2005) CRS 1, a chloroplast
group II intron splicing factor, promotes intron folding through specific
interactions with two intron domains. Plant Cell 17:241-255.
26. Desveaux D, et al. (2004) A "Whirly" transcription factor is required for salicylic
acid-dependent disease resistance in Arabidopsis. Dev Cell 6(2):229-240.
27. Desveaux D, Despres C, Joyeux A, Subramaniam R, & Brisson N (2000) PBF-2
is a novel single-stranded DNA binding factor implicated in PR-I0a gene
activation in potato. Plant Cell 12(8):1477-1489.
28. Desveaux D, Allard J, Brisson N, & Sygusch J (2002) A new family of plant
transcription factors displays a novel ssDNA-binding surface. Nat Struct BioI
9(7):512-517.
29. Y00 HH, Kwon C, Lee MM, & Chung IK (2007) Single-stranded DNA binding
factor AtWHYI modulates telomere length homeostasis in Arabidopsis. Plant J
49(3):442-451.
30. Krause K, et al. (2005) DNA-binding proteins of the Whirly family in
Arabidopsis thaliana are targeted to the organelles. FEBS Lett 579(17):3707-3712.
31. Pfalz J, Liere K, Kandlbinder A, Dietz KJ, & Oelmuller R (2006) pTAC2, -6, and
-12 are components of the transcriptionally active plastid chromosome that are
required for plastid gene expression. Plant Cell 18(1): 176-197.
32. Marechal A, et al. (2008) Overexpression of mtDNA-associated AtWhy2
compromises mitochondrial function. BMC Plant BioI 8:42.
33. Williams P & Barkan A (2003) A chloroplast-localized PPR protein required for
plastid ribosome accumulation. Plant J. 36:675-686.
34. Walbot V & Coe EH (1979) Nuclear gene iojap conditions a programmed change
to ribosome-less plastids in Zea mays. Proc. Natl. Acad. Sci. USA 76:2760-2764.
35. Barkan A (1993) Nuclear mutants of maize with defects in chloroplast polysome
assembly have altered chloroplast RNA metabolism. Plant Cell 5:389-402.
36. Barkan A (1998) Approaches to investigating nuclear genes that function in
chloroplast biogenesis in land plants. Methods Enzymol. 297:38-57.
79
37. Voelker R & Barkan A (1995) Nuclear genes required for post-translational steps
in the biogensis of the chloroplast cytochrome b6fcomplex. Molee. Gen. Genet.
249:507-514.
38. Barkan A (2008) Genome-wide analysis of RNA-protein interactions in plants.
Plant Systems Biology, Methods in Molecular Biology, ed Belostotsky D
(Humana Press).
39. Voelker R, Mendel-Hartvig J, & Barkan A (1997) Transposon-disruption ofa
maize nuclear gene, thaI, encoding a chloroplast SecA homolog: in vivo role of
cp-SecA in thylakoid protein targeting. Genetics 145:467-478.
40. Wong I & Lohman T (1993) A double-filter method for nitrocellulose-filter
binding: application to protein-nucleic acid interactions. Proe. Natl. Acad. Sci.,
USA. 90:5428-5432.
41. Mullet J & Klein R (1987) Transcription and RNA stability are important
determinants of higher plant chloroplast RNA levels. EMBO J 6:1571-1579.
42. Rapp JC, Baumgartner BJ, & Mullet J (1992) Quantitative analysis of
transcription and RNA levels of 15 barley chloroplast genes: transcription rates
and mRNA levels vary over 300-fold; predicted mRNA stabilities vary 30-fold. J.
Bioi. Chem. 267:21404-21411.
43. Klein R & Mullet J (1990) Light-induced transcription of chloroplast genes. J.
Bioi. Chem. 265:1895-1902.
44. Emanuelsson 0 & Heijne Gv (2001) Prediction of organellar targeting signals.
Biochim Biophys Acta 1541:114-119.
45. Small I, Peeters N, Legeai F, & Lurin C (2004) Predotar: A tool for rapidly
screening proteomes for N-terminal targeting sequences. Proteomics 4(6): 1581-
1590.
46. Sato N, Terasawa K, Miyajima K, & Kabeya Y (2003) Organization,
developmental dynamics, and evolution of plastid nucleoids. Int Rev Cytol
232:217-262.
47. Schmitz-Linneweber C, Williams-Carrier R, & Barkan A (2005) RNA
immunoprecipitation and microarray analysis show a chloroplast
pentatricopeptide repeat protein to be associated with the 5'-region ofmRNAs
whose translation it activates. Plant Cell 17:2791-2804.
80
48. Beick S, Schmitz-Linneweber C, Williams-Carrier R, Jensen B, & Barkan A
(2008) The pentatricopeptide repeat protein PPR5 stabilizes a specific tRNA
precursor in maize chloroplasts. Mol. Cell. BioI. 28:5337-5347.
49. Hess WR, et al. (1994) Inefficient rpl2 splicing in barley mutants with ribosome-
deficient plastids. Plant Cell 6:1455-1465.
50. Vogel J, Boerner T, & Hess W (1999) Comparative analysis of splicing ofthe
complete set of chloroplast group II introns in three higher plant mutants. Nucl.
Acids Res. 27:3866-3874.
51. Barkan A (1989) Tissue-dependent plastid RNA splicing in maize: Transcripts
from four plastid genes are predominantly unspliced in leaf meristems and roots.
Plant CellI :437-445.
52. Stahl DJ, Rodermel SR, Bogorad L, & Subramanian AR (1993) Co-transcription
pattern of an introgressed operon in the maize chloroplast genome comprising
four ATP synthase subunit genes and the ribosomal rps2. Plant Molec. BioI.
21 :1069-1076.
53. Schumacher MA, Karamooz E, Zikova A, Trantirek L, & Lukes J (2006) Crystal
structures ofT. brucei MRPl/MRP2 guide-RNA binding complex reveal RNA
matchmaking mechanism. Cell 126(4):701-711.
54. Bollenbach TJ, et al. (2005) RNRl, a 3'-5' exoribonuclease belonging to the RNR
superfamily, catalyzes 3' maturation of chloroplast ribosomal RNAs in
Arabidopsis thaliana. Nucleic Acids Res 33(8):2751-2763.
55. Bellaoui M, Keddie JS, & Gruissem W (2003) DCL is a plant-specific protein
required for plastid ribosomal RNA processing and embryo development. Plant
Mol BioI 53(4):531-543.
56. Bellaoui M & Gruissem W (2004) Altered expression of the Arabidopsis ortholog
ofDCL affects normal plant development. Planta 219(5):819-826.
57. Bisanz C, et al. (2003) The Arabidopsis nuclear DAL gene encodes a chloroplast
protein which is required for the maturation of the plastid ribosomal RNAs and is
essential for chloroplast differentiation. Plant Mol BioI 51(5) :651-663.
58. Zaegel V, et al. (2006) The plant-specific ssDNA binding protein OSB1 is
involved in the stoichiometric transmission of mitochondrial DNA in Arabidopsis.
Plant Cell 18(12):3548-3563.
59. Dorman CJ & Deighan P (2003) Regulation of gene expression by histone-like
proteins in bacteria. Curr Opin Genet Dev 13(2):179-184.
81
60. Kamashev D, Balandina A, Mazur AK, Arimondo PB, & Rouviere-Yaniv J
(2008) HU binds and folds single-stranded DNA. Nucleic Acids Res 36(3):1026-
1036.
61. Kobayashi T, et al. (2002) Detection and localization of a chloroplast-encoded
HU-like protein that organizes chloroplast nucleoids. Plant Cell 14(7):1579-1589.
62. Sato N (2001) Was·the evolution ofplastid genetic machinery discontinuous?
Trends Plant Sci 6(4):151-155.
63. Sato N, Nakayama M, & Hase T (2001) The 70-kDa major DNA-compacting
protein ofthe chloroplast nucleoid is sulfite reductase. FEBS Lett 487(3):347-350.
64. Sekine K, et al. (2007) DNA binding and partial nucleoid localization ofthe
chloroplast stromal enzyme ferredoxin:sulfite reductase. Febs J 274(8):2054-
2069.
65. Lia G, et al. (2003) Supercoiling and denaturation in Gal repressor/heat unstable
nucleoid protein (HU)-mediated DNA looping. Proc Nat! Acad Sci USA
100(20): 11373-11377.
66. Kar" S, Edgar R, & Adhya S (2005) Nucleoid remodeling by an altered HU
protein: reorganization of the transcription program. Proc Natl Acad Sci USA
102(45): 16397-16402.
67. Lewis DE, Geanacopoulos M, & Adhya S (1999) Role ofHU and DNA
supercoiling in transcription repression: specialized nucleoprotein repression
complex at gal promoters in Escherichia coli. Mol Microbiol31 (2):451-461.
68. Balandina A, Kamashev D, & Rouviere-Yaniv J (2002) The bacterial histone-like
protein HU specifically recognizes similar structures in all nucleic acids. DNA,
RNA, and their hybrids. J BioI Chern 277(31):27622-27628.
69. Balandina A, Claret L, Hengge-Aronis R, & Rouviere-Yaniv J (2001) The
Escherichia coli histone-like protein HU regulates rpoS translation. Mol Microbiol
39(4): 1069-1079.
70. Schmitz-Linneweber C & Small I (2008) Pentatricopeptide repeat proteins: a
socket set for organelle gene expression. Trends Plant Sci 13(12):663-670.
71. Williams-Carrier R, Kroeger T, & Barkan A (2008) Sequence-specific binding of
a chloroplast pentatricopeptide repeat protein to its native group II intron ligand.
RNA 14:1930-1941.
82
72. pfalz J, Bayraktar 0, Prikryl J, & Barkan A (2009) Site-specific binding ofa PPR
protein defines and stabilizes 5' and 3' mRNA termini in chloroplasts. EMBO J
28:2042-2052.
73. Okuda K, Nakamura T, Sugita M, Shimizu T, & Shikanai T (2006) A
pentatricopeptide repeat protein is a site recognition factor in chloroplast RNA
editing. J BioI Chem 281(49):37661-37667.
74. Hayes R, et al. (1996) Chloroplast mRNA 3'-end processing by a high molecular
weight protein complex is regulated by nuclear encoded RNA binding proteins.
EMBO J 15:1132-1141.
75. Tsuchiya N, Fukuda H, Sugimura T, Nagao M, & Nakagama H (2002) LRP130, a
protein containing nine pentatricopeptide repeat motifs, interacts with a single-
stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-I. Eur. J.
Biochem.269:2927-2933.
76. Nakamura T, MeierhoffK, WesthoffP, & Schuster G (2003) RNA-binding
properties ofHCFI52, an Arabidopsis PPR protein involved in the processing of
chloroplast RNA. Eur J Biochem 270(20):4070-4081.
77. Steitz JA & Jakes K (1975) How ribosomes select initiator regions in mRNA:
base pair formation between the 3' terminus of 16S rRNA and the mRNA during
initiation ofprotein synthesis in Escherichia coli. Proc Natl Acad Sci USA
72(12):4734-4738.
78. Pyle A & Lambowitz A (2006) Group II introns: ribozymes that splice RNA and
invade DNA. The RNA World, eds Gesteland R, Cech T, & Atkins J (Cold Spring
Harbor Press), 3rd Ed, pp 469-506.
79. Menger M, Tuschl T, Eckstein F, & Porschke D (1996) Mg(2+)-dependent
conformational changes in the hammerhead ribozyme. (Translated from eng)
Biochemistry 35(47):14710-14716 (in eng).
80. Glisovic T, Bachorik JL, Yong J, & Dreyfuss G (2008) RNA-binding proteins and
post-transcriptional gene regulation. FEBS Lett 582(14):1977-1986.
81. Lunde BM, Moore C, & Varani G (2007) RNA-binding proteins: modular design
for efficient function. Nat Rev Mol Cell BioI 8(6):479-490.
82. Auweter SD, Oberstrass FC, & Allain FH (2006) Sequence-specific binding of
single-stranded RJ'J"A: is there a code for recognition? Nucleic Acids Res
34(17):4943-4959.
83
83. Kajava AV (2001) Review: proteins with repeated sequence--structural prediction
and modeling. J Struct BioI 134(2-3):132-144.
84. D'Andrea LD & Regan L (2003) TPR proteins: the versatile helix. Trends
Biochem Sci 28(12):655-662.
85. Jinek M, et al. (2004) The superhelical TPR-repeat domain ofO-linked GlcNAc
transferase exhibits structural similarities to importin alpha. Nat Struct Mol BioI
11(10): 1001-1007.
86. Wharton RP & Aggarwal AK (2006) mRNA regulation by Puf domain proteins.
Sci STKE 2006(354):pe37.
87. Wang X, McLachlan J, Zamore PD, & Hall TM (2002) Modular recognition of
RNA by a human pumilio-homology domain. Cell 110(4):501-512.
88. Loiselay C, et al. (2008) Molecular identification and function of cis- and trans-
acting determinants for petA transcript stability in Chlamydomonas reinhardtii
chloroplasts. Mol Cell BioI 28(17):5529-5542.
89. Hattori M & Sugita M (2009) A moss pentatricopeptide repeat protein binds to
the 3' end of plastid clpP pre-mRNA and assists with mRNA maturation. FEBS J
276(20):5860-5869.