Life Attached: Examining the Implications of Epibiosis on a North Pacific Cirripede and a Gulf 

of Mexico Seep Sabellid  

by  

Lauren N. Rice 

  

A dissertation accepted and approved in partial fulfillment of the   

requirements for the degree of  

Doctor of Philosophy   

in Biology 

  

Dissertation Committee:  

Michelle Wood, Chair  

Craig M. Young, Advisor  

Aaron W.E. Galloway, Core Member  

Erik E. Cordes, Core Member  

Edward B. Davis, Institutional Representative  

 
 

University of Oregon  

 

Summer 2024 

 

 

 



 

2 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

© 2024 Lauren N. Rice  

 This work is licensed under a Creative Commons BY Attribution License. 

 

 

  
  



 

3 

 

 

DISSERTATION ABSTRACT 

 

Lauren N. Rice 

 

Doctor of Philosophy in Biology 

 

Title: Life Attached: Examining the Implications of Epibiosis on a North Pacific Cirripede and a 

Gulf of Mexico Seep Sabellid  

 

 

Epibiotic species, which can either facultatively or obligatorily settle on living hosts, are 

commonly found in marine habitats. Despite this commonality, the biology and ecology for 

many epizoic organisms remain unknown and understudied. In this dissertation, I investigated 

how two marine invertebrate species accommodate life on living hosts.  

 In Chapter II, I discuss the reproductive and settlement patterns for the barnacle 

Solidobalanus hesperius and how they correlate to the molting patterns for host crab species in 

the Oregon subtidal. I found that S. hesperius reproduces year-round and that brooded embryos 

hatch in approximately a week. Furthermore, I utilized a new method to examine the spatial 

distributions of barnacle individuals on their crab hosts and they were tightly correlated to the 

microtopography of the host carapace. 

 The remaining chapters of the dissertation focus on a facultative epibiotic relationship 

found at methane seeps in the Gulf of Mexico, involving a sabellid polychaete species. In 

Chapter III, we found that the species are gregarious settlers and are abundant within the 

methane seep habitats investigated. Furthermore, we present morphological and phylogenetic 

evidence and identify the sabellid as belonging to a new genus and species: Seepicola viridiplumi 

sp. nov. 



 

4 

 

 

 As the newly described sabellid is facultatively epibiotic, Chapter IV examined the 

trophic ecology of the species using stable isotopes. Additional tables showing the statistical 

pairwise comparisons highlighting the effects of season, sample site, and microhabitat on carbon, 

nitrogen, and sulfur isotopic ratios are provided as supplemental materials. We found that S. 

viridiplumi are generalist suspension feeders within the methane seeps and, using microbial 

evidence, show that the species does not rely on chemosynthetic symbionts. The rarefaction 

curves for the sequencing depth is also provided in the supplemental material section. However, 

individuals can occupy differing trophic niches depending on whether they are epibiotic or free-

living.  

 The different trophic niches occupied by epibiotic and free-living S. viridiplumi 

individuals may impact other aspects of the biology for this species. To test this, we examined 

and compared the reproductive output for individuals from each microhabitat using paraffin 

histology. In doing so, we found that epibiotic individuals consistently had slightly larger 

oocytes and higher levels of fecundity. The individual oocyte size distributions for all female 

sabellids examined in this study are shown as a supplemental figure. We also observed an 

apparent lack of gametogenic seasonality in this sabellid species.  

 Taken together, the work presented in this dissertation provides unique insights into how 

epibiotic associations can develop and persist within an ecosystem. The results also provide 

additional insight into the adaptations and biology for epizoic species, which can aid in attempts 

for modeling community functioning.  

 This dissertation includes unpublished co-authored material.  

 

 

 

  



 

5 

 

 

CURRICULUM VITAE 

 

NAME OF AUTHOR:  Lauren N. Rice 

 

 

GRADUATE AND UNDERGRADUATE SCHOOLS ATTENDED: 

 

 University of Oregon, Eugene, Oregon, USA 

 University of Maine, Orono, Maine, USA 

 

 

DEGREES AWARDED: 

 

 Doctor of Philosophy, Biology, 2024, University of Oregon 

 Bachelor of Science, summa cum laude, Marine Science, 2017, University of Maine 

  

 

AREAS OF SPECIAL INTEREST: 

 

 Deep-sea biology 

  

 Reproductive ecology 

 

 Marine Ecology 

  

 

PROFESSIONAL EXPERIENCE: 

 

 Graduate Employee, Department of Biology, University of Oregon, Eugene 

  September 2018 – June 2024 

 

 Research Technician, Waller laboratory, School of Marine Sciences, University of  

  Maine, Orono 

 

 Research Technician, Resource Access International, LLC Labs, Brunswick, Maine 

  Summer 2014 – Summer 2017 

 

GRANTS, AWARDS, AND HONORS: 

 

 Donald E. Wimber Fund Award, University of Oregon, 2023 

 

 Oregon Society of Conchologists Scholarship, Oregon Society of Conchologists, 2022 

 

 William R. Sistrom Memorial Scholarship, University of Oregon, 2020 

  

 University of Oregon First Year Merit Award, University of Oregon, 2018 



 

6 

 

 

 

PUBLICATIONS: 

 

R.A. Beinart, S.M. Arellano, M. Chaknova, J. Meagher, A.J. Davies, J. Lopresti, E.J. 

Cowell, M. Betters, T.A. Ladd, C.Q. Plowman, L.N. Rice, D. Davis, M. Heffernan, 

V. Jimenez, T. Beaver, J. Becker, S. Bergen, L. Brunner, A. Calhoun, M. Hauer, A. 

Taradash, T. Giachetti, C.M. Young (2024) Deep seafloor hydrothermal vent 

communities buried by volcanic ash from the 2022 Hunga eruption. Communications 

Earth and Environment 5: 254. 

 

S. Rist, L.N. Rice, C.Q. Plowman, C.T. Fountain, A.E. Calhoun, C. Ellison, C.M. Young 

(2022) Reproductive biology of the bathyal asteroid Ctenodiscus crispatus in the NE 

Pacific. Invertebrate Biology. doi: 10.1111/ivb.12384  

 

R.G. Waller, R.P. Stone, L.N. Rice, J. Johnstone, A.M. Rossin, E. Hartill, K. Feehan, 

C.L. Morrison (2019) Phenotypic plasticity or a reproductive dead end? Primnoa 

pacifica (Cnidaria: Alcyonacea) in the Southeastern Alaska Region. Frontiers in 

Marine Science 6 (709). doi: 10.3389/fmars.2019.00709. 

 

L.N. Rice, P.D. Rawson, S.M. Lindsay (2018) Genetic homogeneity among 

geographically distant populations of the blister worm Polydora websteri. 

Aquaculture Environment Interactions 10: 437-446. doi:10.3354/aei00281. 

 

 



 

7 

 

 

ACKNOWLEDGMENTS 

 

This work is thanks in large part to the continued support and assistance of family, 

friends, collaborators, and mentors. You all have my deepest gratitude.  

First, my most sincere thank you to my advisor, Dr. Craig Young. You have given me so 

many amazing opportunities over the years, starting with the chance to work in your lab as a PhD 

student. You have taught me so much, from how to build experimental equipment for 

deployment at sea, how to prep for a research cruise, the best ways to use a microscope, and how 

to pivot when things aren’t going according to plan. There have been so many moments working 

with you that I will cherish. 

I am ever thankful to my advisory committee members. Michelle Wood, you have 

provided so much advice and guidance over the past several years, and I have always been 

appreciative of all the discussions over coffee. Edward Davis, thank you for always keeping me 

on track with statistics and for your advice. Aaron Galloway, thank you for pushing me to look at 

the bigger picture and for your advocacy. Erik Cordes, thank you for all the advice, wisdom, and 

help over the years Erik Cordes. I could not have asked for a better committee. Thank you all for 

the encouragement and kind words along the way.   

My biggest and most sincere gratitude is extended to my lab mates: Caitlin Plowman and 

Avery Calhoun. Caitlin, you welcomed me wholeheartedly from the onset and provided 

friendship, mentorship, and guidance countless times over the years. Words cannot express the 

depth of my gratitude and appreciation. Avery, you always brought such a unique perspective 

and found a way to keep everyone in the lab smiling. Thank you for all your help and friendship 

and commiseration.  



 

8 

 

 

A huge thank you to the whole of the Oregon Institute of Marine Biology (OIMB) 

community. This campus has been my home for the past 6 years, and my work would not have 

been possible without all of you.  Trish Mace, Laura Screen, Jeremy Worthington, Ian 

Washington, Bradd Beckett, James Johnson, Trystan Berry: thank you all for your friendship 

over the years, and for all that you do to keep this campus running.  

To the OIMB grad student community (and extended partners), thank you for all your 

advice, guidance, support, commiseration, and friendship. Erin Jezuit, Christina Ellison, Nicole 

Nakata, Jesse Borland, you have all done so much to make this tiny campus feel like home and 

have brought so much to this community.  

This work would not have been possible without the support of the William R. Sistrom 

Memorial Fellowship of the University of Oregon, and the Oregon Society of Conchology 

Scholarship. This work and my degree was also supported by the NSF grants 1851383 and 

1737382. 

Lastly, I must thank my parents, Mike and Lori Rice, as well as my brothers, Garrett, and 

Ryan. You have all supported this crazy dream of mine since I first set my heart towards this path 

so many years ago. Your encouragement never wavered, despite all the late-night calls, years spent 

apart due to distance and COVID, and even when you had no idea what I was talking about. Words 

cannot capture my gratitude and love.   

 

  



 

9 

 

 

 

DEDICATION 

 

 

 

 

 

 

 

 

 

 

 

And to my grandmothers and my parents. You gave me all that I have, believed in me from the 

start, and reminded me how deep resilience can be in the face of hardship. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



 

10 

 

 

TABLE OF CONTENTS 

 

I. INTRODUCTION .................................................................................................... 15 

II. PATTERNS OF DISTRIBUTION AND REPRODUCTION IN THE  

EPIZOOIC BARNACLE SOLIDOBALANUS HESPERIUS AND THEIR 

CORRELATION WITH THE LIFE HISTORIES OF THEIR HOSTS ...................... 19 

1. Introduction ...................................................................................................... 19 

2. Materials and Methods  .................................................................................... 21 

2.1. Reproduction in Solidobalanus hesperius ................................................ 21 

 2.2. Distribution of Barnacle Settlers on Metacarcinus magister .................... 24 

 2.3. Statistical Analysis  ................................................................................... 26 

3. Results  ............................................................................................................. 27 

4. Discussion  ....................................................................................................... 35 

5. Conclusions ...................................................................................................... 38 

III. A NEW GENUS AND SPECIES OF FEATHER DUSTER WORM 

(ANNELIDA, SABELLIDA) FROM SHALLOW HYDROCARBON 

SEEPS IN THE GULF OF MEXICO .......................................................................... 40 

1. Introduction ...................................................................................................... 40 

2. Materials and Methods  .................................................................................... 41 

2.1. Sample Collection  .................................................................................... 41 

 2.2. Species Abundance Estimates................................................................... 42 

 2.3. Molecular Analysis  .................................................................................. 43 

3. Results  ............................................................................................................. 46 

3.1. Systematics  .............................................................................................. 46 

3.2. Phylogenetic Analysis ............................................................................... 69 

3.3. Species Abundance Measures  .................................................................. 71 

4. Discussion  ....................................................................................................... 72 

IV. TROPHIC NICHES AND THE ASSOCIATED MICROBIAL 

COMMUNITY FOR A NEWLY DESCRIBED METHANE SEEP 

SABELLID .................................................................................................................. 74 

1. Introduction ...................................................................................................... 74 

2. Materials and Methods  .................................................................................... 79 

2.1. Sample Collection  .................................................................................... 79 

 2.2. 16S rRNA Sequencing and Analysis ........................................................ 81 



 

11 

 

 

 2.3. Stable Isotope Analysis  ............................................................................ 84 

3. Results  ............................................................................................................. 85 

3.1. Microbial Communities  ........................................................................... 85 

3.2. Nutrient Resources  ................................................................................... 90 

3.3. Trophic Niches for Epibiotic and Free-living Seepicola viridiplumi  ....... 94 

4. Discussion  ....................................................................................................... 96 

5. Conclusions  ..................................................................................................... 100 

V. IMPACTS OF EPIBIOSIS ON THE REPRODUCTIVE PATTERNS 

OF A SABELLID POLYCHAETE FROM GULF OF MEXICO 

METHANE SEEPS ..................................................................................................... 102 

1. Introduction ...................................................................................................... 102 

2. Materials and Methods  .................................................................................... 104 

2.1. Study Sites  ............................................................................................... 104 

 2.2. Sample Collection  .................................................................................... 105 

 2.3. Histology  .................................................................................................. 108 

2.4. Reproductive Analysis  ............................................................................. 109 

 2.5. Statistical Analysis  ................................................................................... 111 

3. Results  ............................................................................................................. 112 

4. Discussion  ....................................................................................................... 118 

5. Conclusions  ..................................................................................................... 122 

V. CONCLUSION ....................................................................................................... 124 

REFERENCES CITED ................................................................................................ 127 

SUPPLEMENTAL FILES ........................................................................................... 143 

 



 

12 

 

 

LIST OF FIGURES 

 

Figure Page 

 

2.1  Live Cancer productus crab with Solidobalanus hesperius barnacles ................. 22 

 

2.2  Gametogenic ranking of Solidobalanus hesperius ovaries ................................... 23 

 

2.3  Percent frequency distributions for Solidobalanus hesperius gametogenic 

  stage ...................................................................................................................... 29 

 

2.4  Linear relationships for Solidobalanus hesperius against host crabs ................... 30 

 

2.5  Average barnacle size and proportion of new settlers by collection month ......... 32 

 

2.6  Solidobalanus hespeirus distributions in relation to carapace 

  microtopography ................................................................................................... 34 

 

3.1  In situ images of Seepicola viridiplumi ................................................................ 49 

 

3.2  Radiolar crown and thoracic region for Seepicola viridiplumi ............................. 51 

 

3.3  Seepicola viridiplumi anterior and posterior views .............................................. 52 

 

3.4  Seepicola viridiplumi radiole morphology ............................................................ 53 

 

3.5  Thoracic chaete of Seepicola viridiplumi ............................................................. 56 

 

3.6  Collar and abdominal chaete for Seepicola viridiplumi ........................................ 57 

 

3.7  Apical view of peristomium for Seepicola viridiplumi ......................................... 58 

 

3.8  Scanning electron micrographs of thoracic chaete ............................................... 59 

 

3.9  Abdominal chaete and uncini under SEM ............................................................ 60 

 

3.10 Maximum likelihood tree showing sabellid phylogenetic relationships.............. 70 

 

4.1  Artistic depiction of the microhabitats occupied by Seepicola viridiplumi .......... 78 

 

4.2  Microbial diversity associated with Seepicola viridiplumi radiolar crowns ......... 87 

 

4.3  Comparisons of microbial diversity on Seepicola viridiplumi  ............................ 89 

 

4.4  Isotopic ratios for the three study sites by collection ............................................ 93 

 



 

13 

 

 

4.5  Trophic niche plots for Seepicola viridiplumi  ..................................................... 95 

 

5.1  Map of study sites within the Gulf of Mexico ...................................................... 105 

 

5.2  Color corrected in situ images of Seepicola viridiplumi ....................................... 107 

5.3  Gametogenic stages for Seepicola viridiplumi  .................................................... 110 

5.4  Comparisons of body length between epibiotic and free-living Seepicola 

   viridiplumi  ............................................................................................................  113 

5.5  Oocyte size frequency histograms by site and collection ..................................... 115 

5.6  Percent frequency distributions of pooled gametogenic stages ............................ 116 

5.7  Comparisons of reproductive output between epibiotic and free-living 

  Seepicola viridiplumi ............................................................................................  118  

  

  



 

14 

 

 

LIST OF TABLES 

 

Table Page 

 

 

2.1  Proportions of observed Solidobalanus hesperius barnacles with broods 

  by collection month............................................................................................... 28 

 

2.2  Proportions of brooded embryos against ovarian gametogenic stage ................... 28 

 

3.1  Specimen IDs for Seepicola viridiplumi with accession numbers ........................ 45 

3.2  Distinctive features of the genera Seepicola, Perkinsiana, Potamilla, 

  and Pseudopotamilla  ............................................................................................    63 

4.1  Collection information and sample sizes for Seepicola viridiplumi  .................... 80 

4.2  Sample collection information and 16s rRNA bioinformatic details .................... 83 

4.3  Average isotopic values by collection .................................................................. 91 

4.4  Results of two-way ANOVAs examining stable isotopic trendss ........................ 92 

5.1  Collection information and sample sizes .............................................................. 106 

5.2  Kruskal-Wallis test results comparing oocyte size distributions .......................... 114 

5.3  Mean oocyte sizes for each site and collection of Seepicola viridiplumi  ............ 115 

  



 

15 

 

 

CHAPTER I 

INTRODUCTION 
 

Habitats along continental shelves and slopes are dominated by soft bottom habitats 

composed of sand and mud, and rocky substrata are often patchy and scarce. The marine 

communities that occur on hard surfaces are frequently dominated by sessile invertebrate fauna, 

leading to competition for space and access to settlement locations (Jackson 1977, Osman 1977, 

Harder 2009, Wahl 2009). This intense competitive pressure is thought to have given rise to a 

commensal, spatial association known as epibiosis (Wahl 1989). In this association, a sessile 

organism called an epibiont, settles on and attaches to the surface of a living host, called a 

basibiont (Wahl 1989, 1997, 2009). Epibiotic organisms are represented by a diverse array of taxa, 

including polychaetes, bryozoans, tunicates, mollusks, diatoms, rotifers, barnacles, and sponges 

(Wahl 2009). Epibiotic species can be further categorized as epizoans (animals) or epiphytes 

(algae) and can either facultatively or obligatorily settle on living substrates (Wahl & Mark 1999).   

Epibiotic associations have been regarded as non-symbiotic due to their predominantly 

facultative nature and lack of obligate trophic exchange (Wahl 1989, 2009, Wahl & Mark 1999, 

Romero et al. 2022). However, epibiosis is still frequently categorized as an interspecies 

relationship (McLeod et al. 2020) where differing species “live together” in physical contact 

(Martin & Schwab 2012, Esteban & Fenchel 2020). In this dissertation, we identify epibiosis as a 

symbiotic, commensal association in recognition of the broad definition of symbiosis (Martin & 

Schwab 2012), the previous studies categorizing the outcomes of these associations (e.g. Uriz et al. 

1992, Silina & Zhukova 2014, Puccinelli & McQuaid 2021), and the examples of obligate 

epibiotic species (e.g. Thamrin et al. 2001, Nájera-Hillman et al. 2012, Robinson et al. 2019). 



 

16 

 

 

Although there are some notable exceptions (McLeod et al. 2020), epibiotic species are 

usually smaller than their hosts and frequently act as abundant, primary consumers (Chen et al. 

2021). Epibiotic associations can be observed at most latitudes, depths, and marine habitats (Wahl 

2009). Despite this ubiquitous presence, many epizoan species are understudied compared to the 

host taxa. This is primarily due to the smaller size of epizoic species, greater difficulty in sampling 

and processing, epizoans compared to hosts, and that epizoans often belong to taxa with poor 

phylogenetic resolution and are difficult to identify (Chen et al. 2021). The advantages and 

disadvantages of epibiotic settlement has been well studied (Wahl 1989, 1997, 2009, Harder 2009). 

More frequently, however, studies attempt to identify and categorize the nature of epibiotic 

relationships from the perspective of the basibiont (e.g. Xu & Burns 1991, Wargo & Ford 1993b, 

Manning & Lindquist 2003, Eschweiler & Buschbaum 2011, Burris et al. 2014, Silina & Zhukova 

2014). This focus often fails to capture the dynamic nature of the relationships (Zapalski 2011) and 

overlooks the biology and ecology of the epizoan.  

In this dissertation, I sought to investigate how epizoan species adapt to life on living hosts. 

Some generalizations have been proposed for how epibiotic species have adapted, including 

abbreviated life spans compared to free-living relatives, the ability to facultatively or obligately 

undergo asexual reproduction, and general trophic independence from their host (Wahl & Mark 

1999, Fernandez-Leborans 2010). However, quantitative evidence supporting these claims remains 

scant, especially given the commonality of epibiotic associations. The following chapters focus on 

two different epizoic species and examine how epibiotic life impacts settlement timing, patterns of 

reproduction, and trophic ecology.  

In Chapter II, I discuss a species of balanid barnacle local to the Oregon subtidal that is 

primarily attached to crab hosts. While the barnacle is known to be a short-lived species, I 



 

17 

 

 

hypothesized that it has adapted its reproductive cycle to coordinate with the regular molting of the 

host exoskeleton. Additionally, I developed a novel way to investigate the spatial distributions of 

barnacle individuals on the host exoskeleton. Chapter II is unpublished but will include Dr. Craig 

M. Young as a co-author, as he provided editorial assistance.  

Chapters III, IV, and V focus on a facultative hyper-epibiotic species of sabellid feather 

duster polychaete from shallow methane seep habitats within the Gulf of Mexico. While the 

species is highly abundant, the sabellid has remained unidentified. In Chapter III, I present the 

morphological and phylogenetic description of the sabellid and simultaneously erect a new genus. 

This chapter is unpublished and will include co-authors Dr. Mariana Tovar-Hernandez for 

assistance with the morphological description; Christina Ellison, who contributed to the genetic 

identification; and Dr. Craig M. Young who provided funding. All coauthors contributed to 

manuscript preparation.  

While individuals of the newly described sabellid are commonly found in authigenic 

carbonate along the seafloor, they can also be found atop a file clam that is an obligate epizoan on 

tubeworms within methane seeps. This means that epibiotic sabellids may be a meter or more 

above their free-living conspecifics and provides an ideal system to examine the impacts of 

epibiosis on a species from a chemosynthetic habitat, which had not previously been examined. In 

Chapter IV, I hypothesized that the difference in height above the seafloor could impact the diet of 

the sabellid individuals. As a sabellid species at methane seeps off Costa Rica was recently found 

to harbor chemosynthetic bacterial symbionts (Goffredi et al. 2020), I also investigated the 

microbial communities associated with the newly described sabellid between each microhabitat. 

Chapter IV is unpublished but will include Dr. Stilianos Louca for assistance with microbiome 

analysis and manuscript preparation, Dr. Erik Cordes for project guidance and assistance with data 



 

18 

 

 

interpretation, and Dr. Craig M. Young for funding and manuscript preparation assistance.  

In Chapter V, I hypothesized that any potential differences in diet and trophic ecology may 

influence the overall fitness of sabellids from each microhabitat. Thus, I examined the reproductive 

patterns of the newly described sabellid in order to: 1) obtain the first reproductive data for any 

deep-water sabellid species, and 2) determine if there was a difference in reproductive output (i.e. 

fecundity and oocyte size) between epibiotic and free-living sabellids. Chapter V is unpublished 

but will include Dr. Craig M. Young as a coauthor for providing funding and assistance with 

manuscript preparation. 

Despite the commonality of epibiotic species in marine ecosystems, many epizoans remain 

unidentified (Chen et al. 2021), and the biology and ecology of these organisms largely remain 

unknown. As these associations have the potential to drive environmental change (McLeod et al. 

2020), there is a need to better understand the species diversity that exists for epizoans and their 

ecological roles both from a trophic perspective and due to the influences they can exert on host 

taxa (Wahl 1989, 2009, Chen et al. 2021). The work presented here directly addresses some of 

these key knowledge gaps. 

  



 

19 

 

 

CHAPTER II 

PATTERNS OF DISTRIBUTION AND REPRODUCTION IN THE EPIZOOIC 

BARNACLE SOLIDOBALANUS HESPERIUS AND THEIR CORRELATION 

WITH THE LIFE HISTORIES OF THEIR HOSTS 
 

This work includes coauthor Dr. Craig Young as contributor to manuscript preparation.  

1. INTRODUCTION 

Continental shelves are generally dominated by soft-bottom habitats made of sand and 

mud, and rocky substrata can be scarce and patchy. Sessile invertebrates living on marine hard 

bottoms often experience intense competition for settlement sites and space to grow (Osman 1977, 

Harder 2009, Wahl 2009). Epibiosis is a common strategy among sessile suspension- and filter-

feeding species (Wahl 1989), and biological substrata increase the available surfaces that can be 

used for settlement (Gili et al. 1993). For example, crabs and other decapods found in areas with 

sandy bottoms often support epibiotic communities (Heath 1976, Gili et al. 1993, Negreiros-

Fransozo et al. 1995, Key et al. 1997, Pasternak et al. 2002, McGaw 2006, Campos et al. 2022, 

Dvoretsky & Dvoretsky 2023). Potential advantages of epibiotic settlement on a crab include 

increased access to food particles due to the activities of the host (Heath 1976) and protection from 

predators (Key et al. 1997, Harder 2009, Wahl 2009). At the same time, epibionts must contend 

with host behaviors such as hiding in crevices, burial (Negreiros-Fransozo et al. 1995, Becker & 

Wahl 1996), and the periodic molting of the exoskeleton (Gili et al. 1993). Many epibiotic species 

have high rates of growth and reproduction as well as abbreviated life cycles (Jackson 1977, Seed 

1985), which may allow epibionts to accommodate to the ephemeral availability of a crab 

exoskeleton. In this study, we sought to examine a short-lived acorn barnacle to determine if the 

reproductive patterns might be related to the molting of their host crabs.   



 

20 

 

 

Acorn barnacles are frequently found as epibionts and have been well-documented on sea 

turtles (Farrapeira 2010, Razaghian et al. 2019, Robinson et al. 2019), shellfish (Gabaev 2013, 

Silina & Zhukova 2014, Puccinelli & McQuaid 2021), corals (Newman et al. 1976, Lewis 1992, 

Thamrin et al. 2001, Frick & Ross 2002), crabs (Heath 1976, Key et al. 1997, McGaw 2006, 

Campos et al. 2022), and horse shoe crabs (Key et al. 1996, Lim et al. 2021). On crabs, epibiotic 

barnacles have been shown to concentrate in grooved regions of the carapace (Heath 1976, Key et 

al. 1997, McGaw 2006).  

The barnacle Solidobalanus hesperius (formerly Hesperibalanus) is broadly distributed 

across the North Pacific, with most observations and studies from the Sea of Japan (Zhukova 2000, 

Silina 2002, Korn & Scherbakova 2012). Fewer observations come from Washington (Barnes & 

Barnes 1959) and Oregon (Shanks 2001, Carlton 2007, Meyer et al. 2018) despite a long-term 

history of presence in the area (Zullo & Marincovich 1990). Solidobalanus hesperius frequently 

settle as epibionts on crabs and cultured shellfish (Zhukova 2000, Korn & Scherbakova 2012, 

Gabaev 2013) and are readily outcompeted for space by other organisms such as algae 

(Ovsyannikova 2010). The species is reported to have a short life span of six to seven months, with 

few individuals surviving longer than a year (Ovsyannikova & Levin 1982), and has been 

described as a pioneer species (Meyer et al. 2018). However, little is known about the ecology and 

settlement patterns of S. hesperius outside the Sea of Japan, and no study has examined adult 

populations in the Eastern Pacific.  

This study investigated aspects of distribution and life-history biology in S. hesperius 

barnacles attached to Dungeness (Metacarcinus magister) and red rock crabs (Cancer productus). 

Both crab species are abundant off Oregon, important to local fisheries, and can be found 

overlapping in several habitats (Orensanz & Gallucci 1988). While epibiotic communities for M. 



 

21 

 

 

magister and C. productus have been examined in British Columbia (McGaw 2006), the 

relationship between S. hesperius and the crab hosts remains unstudied. Here, we sought to 

investigate the reproductive and settlement patterns for S. hesperius in relation to the known 

molting patterns of the host crab species. Furthermore, recent work examining the distribution 

patterns of epibiotic barnacles on crabs have relied on methods that divide the host exoskeleton 

into broad regions (Heath 1976, Key et al. 1997, McGaw 2006). Such methods do not capture fine-

scale patterns and are often difficult to replicate on new host species. We developed and utilized a 

novel method to examine the density and spatial distributions of S. hesperius on the dorsal surfaces 

of M. magister. This method can easily be applied to other species.  

2. MATERIALS AND METHODS 

2.1 Reproduction in Solidobalanus hesperius 

To determine the reproductive seasonality of Solidobalanus hesperius, we collected live 

specimens monthly from host crabs between June 2022 and May 2023, except for October and 

November 2022. Metacarcinus magister and Cancer productus crabs with epibiotic barnacles were 

collected using baited crab pots deployed from either the pier at the Oregon Institute of Marine 

Biology campus (43°20'59"N 124°19'49"W), or the nearby docks at the Charleston Marine Life 

Center (43°20'43"N 124°19'41"W) during times of significant swell. Monthly collections were at 

least three weeks apart. Crab pots were deployed for 8-hour intervals and were checked hourly. 

Any crabs with attached barnacles were kept for further processing.  

The carapace length and width of each crab were measured, with carapace width being 

defined as the distance between the bases of the tenth pair of anterolateral spines. We measured 

from the base of the anterolateral spines to avoid inconsistencies caused by broken or eroded 

spines. Carapace length was measured as the distance between the tip of the rostrum and the 



 

22 

 

 

posterior edge of the carapace. Epibiotic barnacles were identified using Light and Smith’s manual 

(Carlton 2007), counted, and approximate locations on the crab host were recorded (i.e. dorsal, 

ventral, appendages). Crabs were then imaged using a Canon PowerShot G12 digital camera 

(Figure 2.1). Only barnacles identified as Solidobalanus hesperius were removed using a scraper 

and forceps and isolated into individual bowls of seawater filtered through a 0.45 μm membrane 

filter. This was done to ensure that hatching nauplii (if present) could be counted and tracked to an 

individual barnacle. For each collection, barnacles were randomly chosen across the full available 

size range. We measured both carnia-rostrum and lateral diameters for each barnacle before 

removing the visceral mass to expose the ovary and coelomic cavity. Using a Zeiss Stemi 508 

microscope fitted with a Zeiss Axiocam 208 camera, micrographs were taken of the ovary (Figure 

2.2), which was then ranked for gametogenic stage using the protocols of Hines (1976) and Yan et 

al. (2006).  

 
Figure 2.1. Live Cancer productus crab bearing adult Solidobalanus hesperius (sh) and newly settled individuals 

(ns). Scale bar represents 2 cm.  



 

23 

 

 

 
Figure 2.2. Gametogenic ranking of Solidobalanus hesperius ovaries: (A) Stage 1– no ovary is visible in the basal 

membrane (bm); (B) Stage 2 – rudimentary ovarian structures (ro) are faintly discernible as a grainy texture; (C) 

Stage 3 – a moderately developed ovary (o), which has a yellow coloration and slight grainy appearance; (D) Stage 

4 – a fully developed, opaque yellow ovary filled with observable ova (oa) with visible testes. All scale bars 

represent 1 mm.  

 

If present, brooded embryos from each barnacle were transferred into separate bowls of 

0.45 μm filtered seawater and kept partially submerged in a flow-through seawater table. Water 

temperature was recorded daily. Water was changed daily, and developmental stage was checked 

every 24 hours to determine an estimated time to hatching. As the time of fertilization was 



 

24 

 

 

unknown, the appearance of certain features (individual cells, appendages, eyespots, first 

movement, appearance of pigment) was used to track progression until hatching. To ensure 

accuracy, only broods judged to be in “early” developmental stages (individual cells visible, but no 

naupliar structures) were included in the final estimates of hatching time. Hatched nauplii from all 

brooding S. hesperius individuals were counted to obtain measurements of fecundity.  

 

2.2 Distribution of Barnacle Settlers on Metacarcinus magister 

To examine patterns of settlement and spatial distribution of S. hesperius on M. magister 

hosts, molted carapaces were collected daily from a one kilometer transect spanning the sandy 

intertidal area in Devil’s Kitchen State Park, Oregon (43°04'57"N 124°26'10"W), from April 30th, 

2020 to April 30th, 2021. Each day, the total number of observed M. magsiter carapaces and the 

number with epibiotic barnacles were recorded. We carefully brushed all carapaces bearing 

epibiotic barnacles to remove sand. A total of 1481 carapaces were collected over the study period, 

and a random subsample of 610, ranging from 2-260 each month depending on availability, was 

selected for image analysis. Carapaces were imaged using a Canon G12 Powershot camera 

mounted on a tripod, and only intact carapaces were included. Images were analyzed in Adobe 

Photoshop (versions 23 and 24.6). Width and length of the crab carapace, as well as carnia-rostrum 

and lateral diameters of barnacles were measured using the Ruler Tool. Only barnacles attached to 

the host carapace were examined; individuals affixed on top of other barnacles were excluded. As 

multiple barnacle species can settle on crab hosts, such as Balanus crenatus and B. glandula, all 

attached barnacles were identified using the Light and Smith Manual (Carlton 2007). As 

individuals could lack the tergum and scutum, the shape of the shell plates were used for species 

identification. Newly settled barnacles were identified as individuals with carnia-rostrum diameters 



 

25 

 

 

less than 1.5 mm. This diameter was selected based on the growth rates described by 

Ovsyannikova & Levin (1982), who reported that metamorphosing S. hesperius cyprids were 

approximately 0.8 mm in diameter and individuals 2.0 mm in diameter were about a month old. 

There was a heightened degree of uncertainty for the species identification of smaller, newly 

settled individuals (<2 mm), and data may include low numbers of other species such as B. 

crenatus and B. glandula. 

Using a novel method with Adobe Photoshop, we analyzed a subset of 483 carapaces, 

including representatives from every size class, to examine spatial patterns of S. hesperius on the 

dorsal surface of M. magister. First, images were straightened so the tenth pair of anterolateral 

spines were horizontal at 180o. Images were then proportionally transformed so the carapace width 

was scaled to 350 mm (arbitrary cutoff). Next, a digital axis origin was manually set in the middle 

of each carapace using the intersection of lines representing carapace length and width as guides. 

The center of each barnacle was then recorded and marked using the coordinate-system built into 

the Photoshop software. The location and number of barnacle clusters, defined as when two or 

more barnacles were in contact, were also recorded. The transformation of carapace length created 

a unified observation area and consistent coordinate plane among crabs of various body sizes. This 

enabled the spatial distributions to be aggregated and viewed against a hypothetical, standardized 

dorsal carapace.  

To investigate the effects of carapace microtopography on barnacle settlement, a random, 

intact M. magister carapace lacking epibiotic barnacles was imaged using an iPhone 13 (iOSv 

17.2.1). A three-dimensional point cloud and mesh were then generated using Agisoft Metashape 

software version 1.22.6 (2016). The resulting mesh was cleaned and aligned before a 25-step 

interval was applied to generate a scalar height map in CloudCompare version 2.12.4 (2022).  



 

26 

 

 

2.3 Statistical Analysis 

All statistical analyses were conducted in RStudio version 4.2.3 (R Core Team 2023). The 

commonality of C. productus and M. magister bearing S. hesperius varied each month. Thus, we 

pooled measurements of oogenic frequency, fecundity, and barnacle diameter collected from both 

host species into a single dataset prior to statistical analysis. Linear regression analysis was used to 

determine the effect of barnacle size (carnia-rostrum diameter) on fecundity for the live-caught 

barnacles. Chi-square contingency table analyses were used to compare the frequency of oogenic 

stages between collection months.  

Pearson correlation tests were used to examine the linear dependence of the two size 

metrics recorded for each species. After finding strong correlations between the barnacle diameters 

(t = 162.5, p = 2.2e-12) and the carapace measurements (t = 152.99, p = 2.2e-12), we used carnia-

rostrum diameters and carapace width measurements in all subsequent statistical tests as proxies 

for barnacle and crab size. Linear regression was used to examine the relationship between the size 

of molted M. magister carapaces and the number and size of attached S. hesperius individuals. We 

also examined the relationship between carapace size and the number of barnacle clusters. The 

statistical distributions and variances of barnacle size on molted carapaces were examined using 

the Shapiro-Wilk test (Shapiro & Wilk 1965) and Levene’s Test (Levene 1960), respectively. 

Measurements of barnacle size for each month were compared using the Kruskal-Wallis Test 

(Kruskal & Wallis 1952) and Dunn’s post hoc test (Dunn 1964) with p-value adjustments made 

using the Holm Method (Holm 1979). To examine the spatial point patterns for individual S. 

hesperius barnacles and barnacle clusters, point distributions were compared to a Complete Spatial 

Randomness (CSR) model using the quadrat method with a 15 x15 division across a standardized 

representation of an M. magister carapace. Spatial distributions were then tested for both 



 

27 

 

 

randomness and levels of spatial clustering, with significance being determined using a chi-squared 

distribution.  

3. RESULTS 

Of the 1232 live barnacles observed on 37 captured crab hosts, the majority were on the 

dorsal carapace (n = 652) and relatively few were found on the ventral side (n = 210). Collected 

crabs had a wide range of epibiotic loads, with several individuals having only a single barnacle 

and one Cancer productus having 150 barnacles. Instances of high epibiotic load were only 

observed in July and August, 2022 and most of the observed barnacles during these months were 

identified as new settlers.  

A total of 162 Solidobalanus hesperius barnacles were dissected to check oogenic stage 

and look for brooded embryos. Brooded embryos were observed at most times of the year, with 

peaks of higher occurrence in June and August 2022, as well as March 2023 (Table 2.1). Broods 

did not appear to correspond to a specific oogenic stage but were slightly more common in 

individuals with ovaries at stages 2 and 4 (Table 2.2). Oogenic stage frequencies varied throughout 

the study period (χ2 = 109.2, p <0.0001; Figure 2.3). The frequency of individuals with stage 1 

ovaries was significantly higher in January and April, and significantly lower in July. Individuals 

with stage 2 ovaries were observed in every month except March and May and had statistically 

significant increases in abundance in December, January, and February (Figure 2.3). Individuals 

with stage 3 ovaries were not observed in December, January, and April. However, stage 3 

individuals were significantly more common in July, August, and May. Mature stage 4 ovaries 

were observed in every month except January and were significantly more common in November 

and March (Figure 2.3).   



 

28 

 

 

Table 2.1. Proportions of observed Solidobalanus hesperius barnacles with brooded embryos by month, starting in 

June 2022 and concluding in May 2023. 

Month Total Number of 

Barnacles Observed 

Number with Broods Proportion with 

Broods (%) 

June 16 8 50 

July 19 4 21.1 

August 19 12 63.2 

November 16 2 12.5 

December 10 0 0 

January 11 0 0 

February 9 2 22.2 

March 21 8 38.1 

April 21 3 14.3 

May 20 2 10 

 

Table 2.2. Proportions of brooded embryos corresponding to each ovarian gametogenic stage for Solidobalanus 

hesperius collected between June 2022 and May 2023. 

 Total Observed Number with Broods Proportion (%) 

Stage 1 43 7 16.3 

Stage 2 19 6 31.6 

Stage 3 43 9 20.9 

Stage 4 54 18 33.3 

 



 

29 

 

 

 
Figure 2.3.  Percent frequency distribution of each oogenic stage for each collection month, starting in June 2022 

and concluding in May 2023. The number of Solidobalanus hesperius individuals examined is shown in Table 2.1. 

Solidobalanus hesperius individuals collected from both Metacarcinus magister and Cancer productus hosts were 

pooled to compensate for erratic collections from each host. 

 

A total of 41 live S. hesperius barnacles were observed with brooded embryos. Of these, 30 

could be used for fecundity counts and 19 were identified as “early” in development. Barnacles 

collected from the same host crab often had brooded embryos at varying stages of development, 

with some broods hatching upon dissection and others being recently deposited. Barnacle fecundity 

increased with body size in a roughly linear relationship (R2 = 0.45, p <0.0001), with larger 



 

30 

 

 

individuals often having larger broods (Figure 2.4A). The sizes of reproductive S. hesperius 

individuals varied; the smallest individual with a stage 4 ovary had a diameter of 3.8 mm and the 

largest had a diameter of 14 mm. The smallest individual with mature testes was 3.0 mm in 

diameter, and the smallest with an observed brood was 4.5 mm.  

 

Figure 2.4. Linear relationships between: (A) barnacle fecundity and carnia-rostrum diameter for all brooding 

females observed in this study (n = 30); (B) the number of barnacles by molted carapace width; (C) the number of 

observed barnacle clusters by molted carapace width; (D) the carnia-rostrum diameters for barnacles by molted 

carapace width. The equations and R2 values for each regression are indicated. Barnacles are S. hesperius and 

molted carapaces are from M. magister. 

 



 

31 

 

 

Embryos developed rapidly, with all 19 broods beginning to hatch as nauplii five to seven 

days after first observation. Isolated broods were exposed to natural fluctuations in seawater 

temperature, which ranged from 10oC to 15oC depending on the season. Broods collected in 

February and March 2023 experienced colder temperatures (10 – 12oC) compared to those 

collected in July and August 2022 (14-15oC). Broods exposed to temperatures around 12oC 

hatched in an average of 6.7 days after first observation (SD ± 0.6), while those reared in 

temperatures around 14.5oC hatched in an average of 5.7 days after first observation (SD ± 0.9).   

From the molted Metacarcinus magister carapaces, the morphometrics of 2158 S. 

hesperius individuals were recorded. Mean S. hesperius sizes fluctuated each month during the 

study period (Figure 2.5A; Table 2.3). The largest body sizes were seen in winter (Nov-Jan) and 

the next highest in late spring (May-Jun). Both peaks were followed by small average body sizes in 

February and August, respectively (Figure 2.5A). The lowest mean body sizes, seen in august, 

correspond to the largest settlement pulse observed during the study (Figure 2.5B). Although this 

trend could include data from Balanus crenatus and B. glandula. A similar peak was also seen to a 

lesser degree in July and September, but the proportions of new settlers remained at approximately 

20% of the population for the rest of the year (Figure 2.5B). Of the 2158 S. hesperius examined for 

morphometrics, 926 were observed in clusters and a total of 325 clusters were identified. Clusters 

consisted of an average of 2.5 (SD ± 1.8) individuals, although clusters with 19 S. hesperius were 

also observed.   



 

32 

 

 

 
Figure 2.5. (A) The average carnia-rostrum diameter for observed Solidobalanus hesperius barnacles attached to 

molted Metacarcinus magister carapaces each month during the collection period, beginning in May 2020 and 

ending in April 2021. Error bars represent 95% confidence intervals. (B) The proportion of new settlers, defined as 

individuals smaller than 1.5 mm in carnia-rostrum diameter, observed each month starting in May 2020 and 

concluding in April 2021. 



 

33 

 

 

 

The number of S. hesperius barnacles did not increase in relation to M. magister carapace 

width (R2 = 0.042, p <0.0001; Figure 2.4B). Crabs 75 mm and larger often had more than 10 

barnacles, but many had only a single S. hesperius. Similarly, the number of barnacle clusters was 

not dependent on the size of the crab host (R2 = 0.0004, p >0.1), with crabs frequently having only 

one to two clusters regardless of size (Figure 2.4C). Carnia-rostrum diameters of barnacles also 

varied greatly on M. magister carapaces regardless of host size (R2 = 0.003, p <0.001; Figure 

2.4D).  

The coordinate locations of 1738 individual barnacles and 237 S. hesprius clusters were 

identified in relation to 483 host crab carapaces. The spatial distributions were pooled and viewed 

against a hypothetical, standardized dorsal carapace (Figure 2.6A). Spatial distributions for both 

individual barnacles and S. hesperius clusters were non-random (clusters: X2 = 216.9, p <0.0001; 

individuals: X2 = 3323.6, p <0.0001) and strongly aggregated in space (clusters: X2 = 216.9, p 

<0.0001; individuals: X2 = 3323.6, p <0.0001). Solidobalanus hesperius individuals and clusters 

were commonly found within areas marked by depressions in the host M. magister dorsal carapace 

(Figure 2.6B), notably in the frontal area behind the rostrum, the depressions in the central region 

of the carapace above the brachial lobes, and along the outer-most edge of the carapace. The epi-

and mesobrachial regions, characterized by higher ridges on the carapace had a lower barnacle 

presence (Figure 2.6).  



 

34 

 

 

 
Figure 2.6. (A) Aggregated distribution of all individual Solidobalanus hesperius barnacles (grey) and barnacle 

clusters (red) across a standardized representation of the dorsal surface of a Metacarcinus magister carapace. (B) 

Color coded visualization of the dorsal microtopography present on the dorsal carapace of a M. magister. The bar 

indicates carapace height scaling (cooler colors indicate lower areas, warm colors indicate higher regions). The scan 

was made of an individual 145 mm in width that had no epibiotic barnacles. 

 



 

35 

 

 

4. DISCUSSION 

The majority of epibiotic barnacles were found on the dorsal carapaces for both 

Metacarcinus magister and Cancer productus hosts, as opposed to the ventral carapace and 

appendages for each species. Similar trends have been reported for other epibiotic taxa on crab 

hosts (Gili et al. 1993, Negreiros-Fransozo et al. 1995, Key et al. 1997, Dvoretsky & Dvoretsky 

2023), and several key factors likely influence this pattern. The dorsal carapace is likely the most 

exposed portion for both M. magister and C. productus hosts. Both species are known to bury 

themselves in sand with only portions of their dorsal carapace remaining visible (Bellwood 2002) 

and can remain covered for prolonged periods of time (McGaw 2005). The ventral carapace likely 

experiences higher rates of abrasion, either from the action of burial in sand or by movement of the 

host over the seafloor (Negreiros-Fransozo et al. 1995), which may result in a lower abundance of 

S. hesperius barnacles. Furthermore, the dorsal surfaces of C. productus and M. magister are more 

exposed to light and cyprid larvae of other species have been shown to use light fields  to aid in 

orientation before settlement (Visscher 1928, Crisp 1974).  

Larval settlement for Solidobalanus hesperius appears to consistently occur in late summer 

for populations in Oregon. In addition to the patterns seen here, the only other reported  

recruitment event we have found for this species was also documented by Meyer et al. (2018) 

between August and October 2014. These results reflect similar findings in the Sea of Japan, where 

S. hesperius larval recruitment peaks from August into the fall (Ovsyannikova & Levin 1982, Korn 

1999, Gabaev 2013). It has been hypothesized that S. hesperius settlement is influenced by changes 

in the velocity of benthic currents (Ovsyannikova & Levin 1982), and indeed observations off 

Oregon  seem to corroborate this (Meyer et al. 2018).  

Mature ovaries with discernible ova were observed every month between June 2022 and 



 

36 

 

 

May 2023, with January being the sole exception. The consistency in oogenic stages, and number 

of broods, observed throughout the sampling period indicate that S. hesperius reproduction may be 

continuous at the population level and that larvae could be produced throughout the year. 

Continuous reproduction has also been reported for populations in the Sea of Japan (Ovsyannikova 

& Levin 1982), where spawning was observed throughout the year. The lack of advanced oogenic 

stages and broods seen in winter (Dec-Jan) months in this study could reflect a reduced sample size 

in those months. Broods were particularly abundant in the June and August collections. This 

species is known to feed on detritus, with an increasing dependence on diatoms as individuals 

grow in size (Zhukova 2000). Diatoms often become increasingly abundant off Oregon throughout 

the summer season due to upwelling (Du & Peterson 2014) and could provide S. hesperius the 

nutrition needed to increase reproductive output.   

Brooded embryos were observed in individuals of various oogenic stages. This could 

indicate the potential for a rapid turnaround between brood cohorts, which was supported by the 

rapid developmental times for broods. Brooding times are known to vary widely among barnacle 

species and across temperature ranges within species, with hatching for Balanus crenatus 

occurring between 15 and 37 days (Hoeg et al. 1987), and between 22 and 27 days for B. glandula 

(Hines 1976). As one-month-old S. hesperius are approximately 2.0 mm in diameter 

(Ovsyannikova & Levin 1982), the small body sizes for reproductively mature individuals seen 

here provide evidence for rapid development and early reproduction in this species.  

While S. hesperius larvae may be present within the plankton throughout the year, peaks in 

settlement and brooding in S. hesperius seemingly correlate with the molting patterns in host crabs. 

Cancer productus are known to molt from June to August (Knudsen 1964), and M. magister molt 

from March through June (Rasmuson 2013). The increased number of competent cyprids in July 



 

37 

 

 

and August could allow for a large and effective recruitment on the abundant, newly hardened crab 

carapaces. As the adults for both host crab species are known to molt annually, this peak in S. 

hesperius settlement ensures that most individuals have the maximal amount of time to grow and 

reproduce. Like most crab species however, M. magister and C. productus juveniles can molt 

several times within a year. The continuous production of larvae and settlement of S. hesperius 

throughout the year could ensure that this species is able to take advantage of any available 

biological substratum. This could include crabs, but also various mollusk species such as scallops 

(Silina & Zhukova 2014). Rapid maturation and a short life cycle of this species probably increase 

the likelihood that individuals on young crabs can reproduce before their host molts.  

When settling on a crab host such as M. magister, S. hesperius individuals appear to favor 

attachment in low points of the microtopography of the dorsal carapace. This is expected, as 

barnacles are well known to settle in depressions and areas of increased topography (Crisp & 

Barnes 1954). Similar patterns have also been documented in other cases of barnacle epibiosis on 

crabs (Heath 1976, Key et al. 1997, McGaw 2006). Barnacles settled on the higher regions of the 

carapace are more exposed to abrasion when the host crab buries into sand (Negreiros-Fransozo et 

al. 1995, Key et al. 1997).  

Solidobalanus hesperius is well adapted to make use of ephemeral, biological substrata. 

While this barnacle species is also reported to settle on bivalves and gastropods, S. hesperius 

appears strongly r – selected (Pianka 1970). Decapod crustacean exoskeletons have been described 

as unsuitable for a variety of epibiotic taxa due to their temporary nature (Gili et al. 1993). 

However, the quick brooding times, coupled with the correlation of S. hesperius reproduction and 

settlement with the molting patterns of common crab species, allow S. hesperius to maximize the 

potential benefits of epibiotic life. These benefits have been well described (Wahl 1989) and 



 

38 

 

 

reviewed (Key et al. 1996). Specifically for S. hesperius, which is readily outcompeted for space 

(Ovsyannikova 2010), settlement on crabs and other organisms likely free individuals from 

competitive pressure.  

The effects of epibiotic organisms on decapod crustacean hosts is an active area of 

research. The nature and composition of the epibiotic community found on the host carapace is 

known to provide information about the growth, molting frequency, and behavior of the host 

(Abelló et al. 1990, Gili et al. 1993). This can be particularly useful when the host species is 

targeted by fisheries, as is the case for both M. magister and C. productus. Furthermore, 

examinations of epibiotic communities from a biodiversity prospective can provide insight for 

shifts in species abundance patterns (Farrapeira 2010, Lim et al. 2021, Dvoretsky & Dvoretsky 

2022, 2023). In general though, many studies on epibiota and epibiotic barnacles seek to 

understand the nature of the association and its potential influence on the health of the host, 

especially as a high epibiotic load is known to have negative impacts (Key et al. 1997, 

Ovsyannikova 2010, Babu et al. 2012, Gabaev 2013, Campos et al. 2022). While knowledge of the 

biology and ecology of the epibiotic species can be gleaned from these studies (Dvoretsky & 

Dvoretsky 2022), research directly investigating the epibiotic species remains comparatively rare.  

5. CONCLUSIONS 

By directly examining the reproductive patterns of Solidobalanus hesperius, we revealed 

that this species has an extremely accelerated life history marked by the early onset of reproductive 

maturity. Furthermore, by reproducing year-round and having a rapid reproductive cycle, S. 

hesperius can accommodate settlement on an unpredictable and ephemeral substratum. Many 

barnacle individuals die, as evidenced by the high numbers of barnacles on molted Metacarcinus 

magister crab carapaces. The reproductive strategies described here ensure that enough members 



 

39 

 

 

of the population can reproduce successfully. We also found that the spatial distributions of S. 

hesperius closely followed the microtopography of the host carapace, and likely enabling 

individual barnacles to persist despite detrimental host behaviors such as burial. 

 

BRIDGE 
 

In Chapter II, I focused on examining how a short-lived epibiotic barnacle species has 

adjusted its reproductive patterns to accommodate life on an ephemeral host crab exoskeleton. 

Nex, I investigated a similar relationship, but in a facultative epibiotic sabellid polychaete found in 

the specialized environment of hydrocarbon methane seeps. For Chapter III, I focused on 

describing the morphology and phylogenetics of the sabellid polychaete. 

  



 

40 

 

 

CHAPTER III 

A NEW GENUS AND SPECIES OF FEATHER DUSTER WORM (ANNELIDA, 

SABELLIDA) FROM SHALLOW HYDROCARBON SEEPS IN THE GULF OF 

MEXICO 
 

This chapter contains unpublished coauthored material. Dr. Mariana Tovar-Hernandez assisted 

with the morphological description, Christina Ellison contributed to the genetic analysis and 

phylogenetic identification, and Dr. Craig Young provided funding. All coauthors contributed to 

manuscript preparation. This chapter is written in the style of Biodiversity Data Journal. 

1. INTRODUCTION 

Polychaetes in the family Sabellidae are diverse with 512 named species across 42 genera 

(Capa et al. 2021). Sabellids are also recognized as a ubiquitous group with representatives 

appearing in a variety of marine habitats, although most species have been described from shallow-

water systems (reviewed by Capa et al. 2019). However, sabellids have been reported up to depths 

of 9735 meters (Levenstein 1961). Sabellid diversity in deep-water habitats is relatively 

undescribed, with only a few reports identifying sabellids to genus name only and others 

identifying only to taxonomic family (Capa et al. 2021).  

Only two sabellid species have been identified from deep-sea chemosynthetic habitats, both 

belonging to the genus Bispira Krøyer, 1856. Bispira wireni (Johansson 1922) was described from 

hydrothermal vent systems in the Okinawa Trough off southern Japan at a depth of 1335 meters 

(Capa et al. 2013). The second species was identified to the genus Bispira, and was found at 

methane seeps from Jaco Scar, Costa Rica at depths of 1768 to 1887 meters depth (Goffredi et al. 

2020). This latter species is a newly identified example of chemosynthetic bacterial symbiosis, 

where strains of methanotrophic Methylococcales bacteria were embedded in the cuticle of the 



 

41 

 

 

radioles (Goffredi et al. 2020). 

In the present study, we report findings of a third sabellid species observed at 

chemosynthetic systems. This species is found in hydrocarbon seeps on the Upper Louisiana Slope 

in the northern Gulf of Mexico. Individuals are facultative, hyper-epibionts and can be found 

burrowed into the valves of Acesta oophaga Järengren, Schander and Young, 2007 file clams as 

well as free-living within authigenic carbonate. These worms have a mix of morphological features 

like those described in the genera Perkinsiana Knight-Jones, 1983 and Pseudopotamilla Bush,  

1905, but not the genus Bispira. The new species described here also has several unique features, 

allowing for the establishment of a new genus and a new species. These findings were also 

supported through genetic analysis. 

 

2. MATERIALS AND METHODS 

2.1 Sample Collection 

Specimens were collected from the hydrocarbon seeps Bush Hill, Green Canyon 234, and 

Brine Pool NR1 using either ROV Jason deployed from the R/V Thomas G. Thompson (expedition 

TN391) or HOV Alvin deployed from the R/V Atlantis (expedition AT50-04). Collections occurred 

in June 2021 and October 2022, respectively. On each collection, individuals from both authigenic 

carbonate and A. oophaga valves were gathered using the vehicle manipulator arm and 

subsequently transported to the surface in insulated collection boxes. After recovery to the ship, 

carbonate slabs were broken into smaller pieces using a hammer and chisel and sabellids were 

isolated from both substrate types using dental picks. Samples were then fixed in buffered 

formalin, washed in water, and stored in 70% ethanol. Tissues used in genetic work were frozen to 

-80oC at sea. Tissue samples from two additional sabellid individuals were post-fixed in Osmium 



 

42 

 

 

Tetroxide for two hours before being dehydrated in a graded ethanol series ending in two 100% 

ethanol baths for 20-minutes each. The tissues were then critical point dried with CO2, mounted on 

stubs, and coated with 20 nm of gold. The stubs were viewed on a Tescan Vega II SBU and ZEISS 

Ultra-55 scanning electron microscope.  

Complete specimens were measured for their mid-thoracic width, trunk length (from 

chaetiger 1 to pygidium) and radiolar crown length. Other features such as the number of radiolar 

pairs, thoracic, and abdominal segments were also counted. Description of the new species is based 

on the holotype, with paratype variations indicated in parentheses. The thoracic glandular pattern 

was described by staining specimens with methyl green. 

Type specimens were deposited in the following collections: Colección Poliquetológica de 

la Universidad Autónoma de Nuevo León (UANL) and Colección Nacional de Anélidos 

Poliquetos de México, Instituto de Ciencias del Mar y Limnología, Universidad Nacional 

Autónoma de México (CNAP–ICML, UNAM). 

 

2.2 Species Abundance Estimates 

Observations of sabellid abundance were quantitatively examined from video footage from 

either the ROV Jason in June 2021, or the HOV Alvin October 2022. Representative image frames 

were randomly selected for analysis from video footage of sabellid collections. As the primary 

mission for the dives was to conduct sample collections and to place scientific instrumentation, 

clear and continuous footage of the seafloor was scattered. Additionally, scaling lasers were 

haphazardly enabled throughout the dives and were often not visible in image frames. Thus, the 

visible surface area for each frame (the area that is well lit and in focus) was estimated using a 

scaling approach based on observable equipment present in the image. The equipment used had 



 

43 

 

 

known dimensions and helped to ensure consistent and accurate scaling. Visible sabellid tubes 

within each frame were counted using ImageJ (NIH). Epibiotic sabellid density was measured by 

counting the number of tubes present on each valve of host Acesta oophaga. All collected A. 

oophaga had their shell length and width recorded. 

 

2.3 Molecular Analysis 

We extracted DNA from each specimen using DNEasy Blood and Tissue Kit (Qiagen) 

following the manufacturer’s protocol. We attempted to amplify and sequence the Folmer region 

of the mitochondrial protein-coding gene cytochrome c oxidase I from each individual using 

universal primers LCO1490 5' GGTCAACAAATCATAAAGATATTGG and HCO2198 5' 

TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al. 1994). Each PCR was performed in a 

20 µL volume using 2 µl of unquantified DNA extract, 200 µM of dNTPs (NE Biolabs), 500 nM 

of each primer (IDT) and 1 unit of Go Taq polymerase with supplied buffer (Promega). We used 

the following thermocycling profile: initial denaturation at 95°C for 2 min, followed by 35 cycles 

of: 1) denaturation, 95°C, 40 s; 2) primer annealing, 45°C, 40 s; 3) primer extension, 72°C, 1 min; 

followed by final extension at 72°C for 2 min. We verified PCR products with gel electrophoresis 

and purified products producing single bright bands of expected size using SV Wizard Gel and 

PCR clean up kit (Promega) according to the manufacturer’s protocol. PCR products were 

sequenced at Sequetech (Mountain View, CA) in both directions using PCR primers.  

We used resulting chromatograms (.ab1 files) in Geneious Prime (Biomatters) for all initial 

sequence processing. Sequences with a low percentage of high-quality bases (< 50%) were 

excluded from subsequent analysis.  For included sequences, we trimmed off PCR primers and 

low-quality end-regions, aligned opposing strands, and manually resolved disagreements between 



 

44 

 

 

them to produce a consensus sequence. Nucleotide bases with combined Phred scores of < 20 were 

converted into “N”s in the consensus sequence or trimmed off. Subsequently, we translated each 

consensus sequence into amino acids using the Invertebrate Mitochondrial code and checked for 

the presence of stop codons. 

We used NCBI nucleotide BLAST search (GenBank) to screen for contamination and aid 

in species identification. The top 20 BLAST matches (based on highest pairwise identity to our 

specimens) were downloaded and included for subsequent analysis. The dataset was then pared to 

retain a single sequence per species/location and exclude sequences originating from beyond the 

Americas. Due to the appearance of morphological features commonly present in both Perkinsiana 

and Pseudopotamilla genera, sequences from both these genera were specifically included in 

phylogenetic analyses: the type species of Pseudopotamilla (P. reniformis (Bruguière 1789) and 

Perkinsiana fonticula (Hoagland 1919), both from their natural range of distribution. In addition, 

species of Eudistylia Bush, 1905 and Schizobranchia Bush, 1905 were also included since they 

constitute part of the apomorphic clade including Perkinsiana and Pseudopotamilla. 

Resulting sequences were aligned using the MAFFT plug-in in Geneious Prime using 

default parameters. The alignment was visually inspected for gaps and irregularities. The final COI 

alignment was trimmed to 594 bp and contained a total of 24 sequences (including seven generated 

in this study). The resulting alignment was used to construct a neighbor-joining tree (not shown) to 

evaluate pairwise diistances among sequences in the study. All original sequences produced in this 

study have been deposited in Barcode of Life Datsystems (BOLD) and GenBank (Table 3.1). 

We used MEGA X (ver.10.1.8): Molecular Evolutionary Genetics Analysis across 

computing platforms (Kumar et al. 2018) on the same alignment to determine the best fitting 

substitution model for the data (using “Find Best DNA/Protein Models ML”) and to estimate the 



 

45 

 

 

phylogeny using Maximum Likelihood. The best fitting model for the dataset was HKY+I,  but not 

by a very wide margin, so we used the top six models to assess the resulting phylogeny’s 

sensitivity to the substitution model: HKY+I, HKY+G+I, TN93+I, TN93+G+I, GTR+I, 

GTR+G+I; (I = has invariant sites G = has a gamma distribution of the data). For each estimation 

we used 1,000 bootstraps, SPR (subtree pruning regrafting heuristic method) level 5, and a branch 

swap filter of “very strong.” For all other settings, we used the default.  

 

Table 3.1. Table of specimen IDs of Seepicola viridiplumi sp, nov. and BOLD accession numbers. 

Collection 

Location 
Latitude Longitude Depth (m) Sample ID 

BOLD 

Process ID 

Bush Hill 27.78237117 -91.50830855 543 BHSa26 GMSE004-24 

    BHSa46 GMSE005-24 

    BHSa68 GMSE006-24 

    BHSa70 GMSE007-24 

Green Canyon 234 27.74614894 -91.22191704 538 GCSa44 GMSE008-24 

    GCSa47 GMSE009-24 

    GCSa49 GMSE010-24 

 

  



 

46 

 

 

3. RESULTS 

3.1 Systematics 

Order SABELLIDA Latreielle, 1825 

Family SABELLIDAE Latreille, 1825 

Seepicola new genus 

Type species. Seepicola viridiplumi n. sp., herein designated, by monotypy. 

ZOOBANK RECORD: urn:lsid:zoobank.org:act:71A03636-1E5F-4734-85F1-C69906B4D666 

DIAGNOSIS 

Medium-size species in the subfamily Myxicolinae with a moderate number of radioles 

arranged in semicircular radiolar lobes. Radiolar crown symmetrical with all radioles nearly same 

length. Radiolar crown with basal, dorsal and ventral flanges. Palmate membrane, radiolar flanges 

and radiolar eyes absent. Pinnules paired. Radiolar tips entire (unbranched). Dorsal lips with mid-

rib (radiolar appendages) and dorsal pinnular appendages. Ventral lips and parallel lamellae 

present. Ventral sacs absent. Ventral peristomial chambers present, located between the ventral 

lappets and parallel lamellae. Peristomial loops absent. Peristomial eyes present. Collar chaetae 

narrowly hooded. Glandular ridge on chaetiger 2 absent. Ventral shields are well differentiated. 

Thoracic chaetae with a superior group of narrowly hooded chaetae, inferior group with paleate 

chaetae. Neurochaetae with tear-drop shaped companion chaetae and avicular uncini (teeth above 

main fang of equal size, hood absent, breast well developed, expanded, handles of medium length). 

Interamal eyespots absent. Abdominal chaetae elongate, broadly hooded (a basal broad knee and 

distal end narrowing abruptly sensu Knight-Jones 1983). Abdominal avicular uncini with teeth 

above the main fang of equal size, breast well developed, short handled. Pygidium without anal 

cirrus. Pygidial eyes absent. 



 

47 

 

 

ETYMOLOGY 

The genus name refers to the fact that the type species was found in hydrocarbon seeps 

(Seeps, combined with the Latin -cola = ‘dweller’). It should be regarded as invariant compound 

noun in apposition (Read et al. 2017; pg. 19).  

Seepicola viridiplumi sp. nov. 

Figures 1-10 

ZOOBANK RECORD: urn:lsid:zoobank.org:act:78FAA822-18F2-4D0E-A31C-FA223BC469E6 

TYPE MATERIAL: 

Holotype (CNAP–ICML, UNAM, 0000): BHSa144, Cruise Code TN391, 14 June 2021, 

27.78237117, -91.50830855, 562 m, epibiotic on Acesta oophaga. 

 

Paratype 1 (CNAP–ICML, UNAM, 0000): BPSa115, Cruise Code AT50-04, 16 October 2022, 

27.723677, -91.279372, 651 m, epibiotic on Acesta oophaga. 

 

Paratype 2 (CNAP–ICML, UNAM, 0000): BHSa167, Cruise Code TN391, 14 June 2021, 

27.78237117, -91.50830855, 562 m, epibiotic on Acesta oophaga. 

 

Paratype 3 (UANL-0000): BPSa92, Cruise Code AT50-04, 16 October 2022, 27.723677, -

91.279372, 651 m, epibiotic on Acesta oophaga. 

 

Paratype 4 (UANL-0000): BHSa127, Cruise Code AT50-04, 15 October 2022, 27.723677, -

91.279372, 562 m, free-living in authigenic carbonate. 

 



 

48 

 

 

Paratype 5 mounted in stubs 1 and 2 for SEM (CNAP–ICML, UNAM, 0000): BPSa88, Cruise 

Code AT50-04, 16 October 2022, 27.723677, -91.279372, 651 m, epibiotic on Acesta oophaga. 

 

Paratype 6 mounted in stubs 4 and 5 for SEM (CNAP–ICML, UNAM, 0000): BPSa123, Cruise 

Code AT50-04, 16 October 2022, 27.723677, -91.279372, 651 m, epibiotic on Acesta oophaga. 

 

DIAGNOSIS 

Radiolar crown symmetrical with all radioles nearly same length, except 2-3 ventral-most 

developing radioles that are shorter than the dorsal radioles. Radiolar tips variable: long-filiform or 

short button-like. Those radioles with short tips have a massive, unknown brown tissue along their 

internal margins. Peristomial chambers ventrally located between the ventral lappets and parallel 

lamellae. Anterior peristomial ring is slightly exposed dorso-laterally between dorsal pockets and 

the lateral collar margin. Mid-dorsal collar margins fused to fecal groove. 

DESCRIPTION 

Gregarious, facultative hyper-epibiotic sabellid with individuals found free-living in 

authigenic carbonate cements and on the file clam Acesta oophaga Järnegren, Schander, and 

Young, 2007 (Figure 3.1). Commonly found at depths between 562 and 651 meters. Radiolar 

crowns a soft green and body a cream to red-brown color in live worms. Preserved worms have a 

dark to pale cream colored body with radiolar crowns appearing whitish. Radiolar crown length is 

7.2 mm (4 – 7.5 mm) with 12 pairs of radioles (all paratypes with 12 pairs). Trunk length is 39 mm 

(28 – 32 mm) with a body width of 2.5 mm (1.4 – 2 mm). Thoracic segments number 15 (13 – 18) 

with 121 abdominal chaetigers (97 – 143). 



 

49 

 

 

 

Figure 3.1. In situ images of Seepicola viridiplumi sp. nov. A) Epibiotic individuals on a host Acesta oophaga file 

clam. Red-pink plumes belong to the siboglinid tube worm Lamellibrachia luymesi. B) Close up of free-living 

individuals and plumes on authigenic carbonate. C) Aggregation of individuals on authigenic carbonate. D) Tube of 

Seepicola viridiplumi sp. nov. with a muddy outer lining and a curled end. Scale bar represents 2 mm.    



 

50 

 

 

Radiolar crown is mostly symmetrical (Figure 3.3B) with the 2 – 3 ventral-most developing 

radioles with long, filiform radiolar tips as long as the space of 12 pinnules (Figure 3.4A). These 

are 1/8 the length of the dorsal radioles. Radiolar lobes are short, as long as the collar segment 

(Figure 3.2A – C), with dorsal flanges. The dorsal pair of basal flanges is long, narrow, erect, and 

translucid (Figure 3.2C, E, 4A) and the ventral pair is short, broad, has a rounded margin, and is 

translucid (Figures 3.2D, 3D, 4A). Radiolar flanges and palmate membrane is absent (Figure 

3.2D). Pinnules are very long, of a similar length along the radioles. Radiolar eyes are absent. 

Except for the ventral-most radioles, the radioles of the holotype have button-like tips and are as 

short as the space of one pinnule (Figure 3.4B). The radioles with short tips have a massive brown 

tissue along their internal margins (Figures 3.4C – H). Near the radiolar tip this tissue is broader 

than that basally, forming a rounded tip that seems like a distal radiolar eye, but this structure lacks 

ommatidia (Figure 3.4D – G). Some paratypes have mixed radiolar tips (long-filiform, short 

button-like). Radiolar skeleton is composed of 4 cells in side view (Figure 3.4E, H). Apparently, 

the crown of paratype 1 (BPSa115) is undergoing regeneration: it is shorter in comparison to the 

holotype and other paratypes, and the pinnules are incipient.  



 

51 

 

 

 

Figure 3.2. Seepicola viridiplumi sp. nov. A) Radiolar crown and thorax, dorsal view. B) Thorax and base of radiolar 

crown, ventrolateral view. C) Thorax and base of radiolar crown, dorsal view. D) Detail of the dorsal basal flange of 

the radiolar crown. E) Detail of the dorsal basal flange of the radiolar crown. A-E) Holotype (CNAP–ICML, 

UNAM, 0000). Abbreviations: bdf = basal dorsal flange, vbf = ventral basal flange. Scale bars: A) 1 mm, B-E) 0.8 

mm. 



 

52 

 

 

 

Figure 3.3. Seepicola viridiplumi sp. nov. A) Collar, ventral view with the right radiolar lobe removed. B) Radiolar 

crown, lateral view. C) Base of the right radiolar lobe. D) Detail of the dorsal lip and ventral basal flange of the 

radiolar crown. E) Posterior end and pygidium. F) Peristomium, frontal view with the radiolar crown removed, 

peristomial chambers indicated with arrows. G) Detail of the mouth and peristomial chambers pointed with arrows. 

A, C, F-G) Paratype 3, B, D-E) Holotype (CNAP–ICML, UNAM, 0000). Abbreviations: d = dorsal, dl = dorsal lip, 

pl = parallel lamella, v = ventral, vbf = ventral basal flange. Scale bars: A-C) 1 mm, D-E, G) 0.5 mm, F) 1.5 mm. 



 

53 

 

 

 

Figure 3.4. Seepicola viridiplumi sp. nov. A) Base of the radiolar crown, lateral view (Paratype 2). B) Radiolar tips. 

C – G) Details of the radiolar tips showing cartilaginous skeletal cells and massive tissue on the inner margin of the 

radioles, attached to the base of the pinnules. H) Detail of radiolar and pinnular skeletal cells. A) Holotype (CNAP–

ICML, UNAM, 0000), B-H) Paratype 1 (CNAP–ICML, UNAM, 0000). Abbreviations: d = dorsal, v = ventral, rt = 

radiolar tips. Scale bars: A) 1 mm, B-G) 150 μm, H) 75 μm. 



 

54 

 

 

The anterior peristomial ring is slightly exposed dorso-laterally between dorsal pockets and 

the lateral collar margin (Figures 3.2E, 7A). The posterior peristomial ring collar has mid-dorsal 

margins fused to fecal groove (Figures 3.2E, 7A) and the dorsal collar margins form two low, 

rounded lappets (Figure 3.2A, C). The dorso-lateral collar margins are entire, forming a “V” 

(Figure 3.2A, C, E). Ventral lappets are triangular with rounded distal margins that are divided 

mid-ventrally by an incision (Figures 3.2D, 3A, 7A). Parallel lamellae are present, forming a 

triangular structure surrounding the mouth ventrally (Figures 3.3A, F – G, 3.7A). A pair of 

translucent chambers lies between the ventral lappets and parallel lamellae, with brown spots 

inside (Figures 3.3A, F – G, 3.7A-B). Peristomial eyes are seen in paratypes 1 (BPSa115) and 2 

(BHSa167) when radiolar crowns were removed (Figure 3.3F). The dorsal lips are triangular, erect, 

and have a mid-rib (radiolar appendages) (Figure 3.3A, C – D) and dorsal pinnular appendages; 

ventral lips are short and rounded, ventral sacs are absent. 

Chaetiger 1 (collar chaetiger): two groups of hooded chaetae (Figures 3.6A-C, 3.7A, C), 

the anterior one with long, narrowly hooded notochaetae (Figures 3.6A-B, 3.7C), and the inferior 

one half as short than the superior one with hoods slightly broader than the superior group (Figures 

3.6C, 3.7C). The ventral shield is rectangular, slightly divided transversally, and higher than the 

following thoracic shields (Figure 3.3A). Chaetigers 2 – 16 (2 – 13, 2 – 15, 2 – 16, or 2- 18) have 

rectangular ventral shields divided transversally in two equal parts; the tori do not contact the 

ventral shields (separated by a reduced space) (Figures 3.2B, 3.3A). Chaetigers have noto- and 

neurochaetae (Figure 3.5A). Notochaetae have two groups (Figure 3.5C, 3.8A): superior group are 

elongate and narrowly hooded; inferior ones paleate and arranged in two rows with pointed mucro 

(Figure 3.5D, 3.8A-C). Neurochaetae with companion chaetae and avicular uncini (Figure 3.5A – 

B, 3.8E-F). Avicular uncini have several rows of small, similar sized teeth above the main fang 



 

55 

 

 

(covering half of the main fang) (Figure 3.8D), the breast is well developed with a high crest above 

the main fang and handles as long as 2.5 times the length of the main fang (or half of handles of 

companion chaetae) (Figure 3.5E – F). The companion chaetae have symmetrical membranes and 

are teardrop-shaped (Figures 3.5B, E, 3.8E-F) with long handles (Figure 3.5A, E).  

Abdominal segments with elongate neurochaetae and broadly hooded (Figures 3.6A-D, 

3.9A), with a basal, broad knee and the distal end narrowing abruptly in all chaetigers (Figures 

3.6E, 3.9F). Those from the last quarter of the body are very long (twice as long as those in the 

anterior abdominal segments) (Figure 3.9B). Notopodial uncini are avicular with several rows of 

teeth above the main fang and extending over ¾ of the main fang (Figure 3.9C, E-G). The breast is 

well defined, and the handles are very short, shorter than the length of the main fang (Figure 3.6F – 

H). The pygidium is rounded and without eyes (Figure 3.3E). The tubes are composed of fine sand 

and curl tightly at the end (Figure 3.1D). Gametes were not observed in either the holotype or the 

paratypes. 

 



 

56 

 

 

 

Figure 3.5. Seepicola viridiplumi sp. nov., thoracic chaetae. A) Thoracic noto- and neurochaetae. B) Companion 

chaetae. C) Notochaetae. D) Inferior rows of paleate chaetae. E). Avicular uncini and companion chaetae. F) Detail 

of heads (main fangs) of uncini. A-F) Holotype (CNAP–ICML, UNAM, 0000). Magnification: A) 4 x, B, D-E) 40 x, 

C) 10 x, F) 100 x. 



 

57 

 

 

 

Figure 3.6. Seepicola viridiplumi sp. nov., collar and abdominal chaetae. A) Collar chaetigers (chaetigers 1). B) 

Superior group of collar chaetigers composed of elongate, narrowly hooded and slightly curved chaetae. C) Inferior 

group of collar chaetigers composed of elongate, hooded chaete broader than the superior group. D) Abdominal 

chaetae. F) Abdominal torus of avicular uncini. G) Details of uncini in side view. A-H) Holotype (CNAP–ICML, 

UNAM, 0000). Magnification: A) 10 x, B-H) 40 x. 



 

58 

 

 

 

Figure 3.7. Seepicola viridiplumi sp. nov. Scanning electron microscopy of peristomium. A) Apical view of 

peristomium (crown removed) and vascular chambers pointed with white arrows, B) detail of vascular chambers 

between right ventral lappet of collar and parallel lamella, C) collar chaetiger with two groups of elongate narrowly 

hooded chaetae. A-B) Stub 1, C) Stub 2 (BPSa88, CNAP–ICML, UNAM, 0000). Abbreviations: apr: anterior 

peristomial ring, d: dorsal, fg: faecal groove, pl: parallel lamellae, pprc: posterior peristomial ring collar, v: ventral, 

1, 2 and 3 in A indicates number of chaetigers. Scale bars: A) 500 μm, B) 200 μm, C) 100 μm. 



 

59 

 

 

 

Figure 3.8. Seepicola viridiplumi sp. nov., thoracic chaetae and uncini under SEM. A) Chaetiger #2, B) chaetiger #5, 

C) detail of paleate chaetae from chaetiger #5, D) dentition of uncini from chaetiger #5, E) torus 5, F) detail of 

companion chaetae from chaetiger # 5. A) Stub 1 (BPSa88, CNAP–ICML, UNAM, 0000), B-C) Stub 5 and D-F) 

Stub 4 (BPSa123, CNAP–ICML, UNAM, 0000). Scale bars: A) 200 μm, B) 100 μm, C) 50 μm, D) 20 μm, E) 100 

μm, F) 50 μm.  



 

60 

 

 

 

Figure 3.9. Seepicola viridiplumi sp. nov., abdominal chaetae and uncini under SEM. A) Anterior abdominal 

chaetiger, B) posterior abdominal chaetiger, C) anterior abdominal torus, D) detail of chaetae from anterior 

abdomen, E, G) uncini dentition, F) detail of broadly hooded chaetae. A-B, D, F) Stub 4 (BPSa123, CNAP–ICML, 

UNAM, 0000), C, E, G) Stub 2 (BPSa88, CNAP–ICML, UNAM, 0000). Scale bars: A-B, D) 200μm, C) 50 μm, E) 

20 μm, F) 100 μm, G) 8 μm. 



 

61 

 

 

GLANDULAR PATTERN 

The ventral shield of the collar, thoracic and abdominal shields stained a deep, uniform blue 

(Figures 3.2B, 3.3A, E). 

ETYMOLOGY 

The species epithet refers to the color of the radiolar crown in living specimens, from the Latin 

viridi, meaning green and -plumi, meaning many plumes. 

REMARKS 

Placing the taxon described here in either Pseudopotamilla Bush, 1905 or Perkinsiana 

Knight-Jones, 1983 is a difficult task when morphology is first examined. The specimens described 

here from hydrocarbon seep habitats in the Gulf of Mexico have dorsal and ventral basal flanges at 

the base of the radiolar crown, such as is described in Pseudopotamilla. However, it lacks the 

remarked compound radiolar eyes and the asymmetrical radiolar crown common in 

Pseudopotamilla species (Table 2). On the other hand, the genus Potamilla Malmgren, 1866 also 

lacks radiolar eyes (Knight-Jones 1983, Fitzhugh 1989). Our specimens cannot be attributable to 

Potamilla because these have dorsal lips elongate, triangular, with mid-rib (radiolar appendages) 

and lacks a palmate membrane, whereas Potamilla have dorsal lips without radiolar appendages, 

but a palmate membrane is present, among other differences (Table 3.2). 

Regarding the genus Perkinsiana, some authors already commented on the existing 

problems. Fitzhugh (1989) emphasized that Perkinsiana Knight-Jones, 1983 is not a definable 

group as there is no evidence to support monophyly. Capa (2007) and Tovar-hernández et al. 

(2012) both described new species of Perkinsiana and remarked on the existing problem of 

properly assigning species to this genus. In the same context, Pseudopotamilla is not defined by 

any synapomorphies (Fitzhugh 1989, Capa 2007). In both genera, species are known to burrow in 



 

62 

 

 

hard limestone, dead coral, barnacles, and mollusk shells (Chughtai & Knight-Jones 1988, Knight-

Jones et al. 2017, Capa et al. 2019, Tovar-Hernández et al. 2020). There are 18 valid described 

species in Perkinsiana and 23 in Pseudopotamilla after Tovar-Hernández et al. (2020), but the 

status of some nominal species in the latter genus are still questionable. 

Our specimens lack the palmate membrane and radiolar flanges present in some 

Perkinsiana species. Additionally, our specimens had abdominal uncini with reduced handles 

whereas these structures are short to medium length in Perkinsiana. Three types of abdominal 

chaetae can be present in species of Perkinsiana whereas these are elongate, broadly hooded 

chaetae in all chaetigers of the new taxon here described. 

Furthermore, the new species described here have unique, distinctive features not 

previously described: the peculiar shape of the radiolar tips, the presence of the brown tissue on the 

radioles, and the presence of a pair of peristomial chambers between the internal wall of ventral 

lappets and parallel lamellae. Other features of chaetae and uncini are typical of Pseudopotamilla. 

As the new species here described, some species of Pseudopotamilla also have tubes curl tightly at 

the end (Knight-Jones et al. 2017), but branched or bifurcated tubes were not seen in the specimens 

here examined, which is indication of asexual reproduction.  



 

 

Table 3.2. Distinctive features of the genera Perkinsiana Knight-Jones, 1983, Potamilla Malmgren, 1866, Pseudopotamilla Bush, 1905 and Seepicola new genus.  

 

Feature 

Perkinsiana Knight-Jones, 

1983 sensu a variety of 

author as specified in each 

feature 

Potamilla 

Malmgren, 1866 

sensu Fitzhugh, 

1989 

Pseudopotamilla Bush, 

1905 sensu Knight-

Jones et al. 2017 

Seepicola new genus 

Radiolar crown Symmetrical with most 

radioles same length (except 

2-3 ventral-most developing 

radioles)(Tovar-Hernández, 

obs. pers.) 

? Asymmetrical with 

longest radioles dorsally 

Symmetrical with all 

radioles same length 

(except 2-3 ventral-most 

developing radioles) 

Dorsal and ventral 

basal flanges of 

crown 

Absent (Tovar-Hernández et 

al. 2012, Capa et al. 2019) 

Absent Present Present 

Palmate membrane Absent (Fitzhugh, 1989, 

Capa, 2007); present or 

absent (Tovar-Hernández et 

al. 2012, Capa et al. 2019) 

Present Absent Absent 



 

64 

 

 

Radiolar flanges Absent (Fitzhugh, 1989, 

Capa, 2007); absent or 

present (Tovar-Hernández et 

al. 2012) 

Absent Absent Absent 

Radiolar eyes Absent Absent Present, unpaired, 

compound in all 

radioles except dorsal 

most pair and some 

ventral most radioles, 

usually limited to 

proximal half of 

radioles 

Absent 

Peristomial eyes Present in juveniles (Capa et 

al. 2019 

? May be present Present 

Mid-rib of dorsal 

lips (radiolar 

appendages) 

Present (Fitzhugh, 1989, 

Capa 2007, Tovar-Hernández 

et al. 2012, Capa et al. 2019) 

Absent Present Present 

Dorsal pinnular 

appendages 

Present (Fitzhugh, 1989); 

present or absent (Capa 2007, 

Tovar-Hernández et al. 2012, 

Capa et al. 2019) 

Present Present Present 



 

65 

 

 

Ventral lips Present (Fitzhugh, 1989, 

Capa 2007, Tovar-Hernández 

et al. 2012, Capa et al. 2019) 

Present Present Present 

Parallel lamellae Present (Fitzhugh, 1989, 

Capa 2007, Tovar-Hernández 

et al. 2012, Capa et al. 2019) 

Present Present Present 

Ventral sacs Absent (Capa 2007, Tovar-

Hernández et al. 2012, Capa 

et al. 2019) 

? Present Absent 

Peristomial 

chambers 

Never reported Never reported Never reported Oval, translucent with a 

brown spot inside 

Anterior margin of 

anterior 

peristomial ring 

Low, of even height all 

around (Fitzhugh, 1989, Capa 

2007, Tovar-Hernández et al. 

2012) 

Low, of even height 

all around 

Low, of even height all 

around 

Low, of even height all 

around 



 

66 

 

 

Collar chaetae Arranged in oblique rows, 

similar to superior 

notochaetae of following 

chaetigers (elongate, 

narrowly hooded) (Capa 

2007, Tovar-Hernández et al. 

2012, Capa et al. 2019) 

? Similar to superior 

notochaetae of 

following chaetigers 

(elongate, narrowly 

hooded) 

Two groups of hooded 

chaetae, the anterior one 

with long, narrowly-

hooded chaetae, and the 

inferior one half as short 

than the superior one 

with hoods slightly 

broader than the superior 

group 

Inferior thoracic 

notochaetae 

Paleate, arranged in two or 

more transverse rows 

(Fitzhugh, 1989, Capa 2007, 

Tovar-Hernández et al. 2012) 

Paleate, arranged in 

two or more 

transverse rows 

Paleate, arranged in two 

or more transverse rows 

Paleate, arranged in 2-3 

transverse rows 

Thoracic uncini 

(avicular) 

Teeth above main fang of 

equal size, hood absent, 

breast well developed, 

expanded; handles of medium 

length (Fz, 1989); handles of 

variable length (Capa 2007, 

Tovar-Hernández et al. 2012, 

Capa et al. 2019) 

Teeth above main 

fang of equal size, 

hood absent, breast 

well developed, 

expanded; handles 

of medium length 

Teeth above main fang 

of equal size, hood 

absent, breast well 

developed, expanded; 

handles of medium 

length 

Teeth above main fang 

of equal size, hood 

absent, breast well 

developed, expanded; 

handles of medium 

length 



 

67 

 

 

Companion 

chaetae 

Distal ends as roughly 

symmetrical, tear-drop 

shaped membranes (Fitzhugh 

1989, Capa 2007, Tovar-

Hernández et al. 2012, Capa 

et al. 2019) 

Distal ends as 

roughly 

symmetrical, tear-

drop shaped 

membranes 

Distal ends as roughly 

asymmetrical, tear-drop 

shaped membranes 

Distal ends as roughly 

asymmetrical, tear-drop 

shaped membranes 

Abdominal uncini 

(avicular) 

Teeth above the main fang of 

equal size; breast well 

developed, expanded; long 

handled (Fitzhugh, 1989); 

short to medium length 

handle (Capa 2007, Tovar-

Hernández et al. 2012) 

Teeth above the 

main fang of equal 

size; breast well 

developed, 

expanded; long 

handled 

Teeth above the main 

fang of equal size; 

breast well developed, 

expanded; medium 

handled 

Teeth above the main 

fang of equal size; breast 

well developed; short 

handled 



 

68 

 

 

Abdominal chaetae Elongate, broadly hooded 

chaetae in all chaetigers 

(Fitzhugh, 1989, Capa, 2007). 

Broadly-hooded and 

progressively tapering to 

distal tip (type A), or elongate 

broadly-hooded chaetae (type 

B), or elongate, narrowly-

hooded chaetae (type C) 

(Tovar-Hernández et al. 

2012). Anterior abdominal 

segments with broadly 

hooded chaetae and posterior 

segments with elongate, 

narrowly hooded chaetae  

(Capa et al. 2019) 

Elongate, broadly 

hooded chaetae in 

all chaetigers 

Elongate, broadly 

hooded chaetae in all 

chaetigers 

Elongate, broadly 

hooded chaetae in all 

chaetigers, but those 

from the last abdominal 

quarter being longer than 

anterior abdominal 

segments 



 

69 

 

 

3.2 Phylogenetic Analysis 

 

All phylogenetic estimations recovered the same topology with very minor variations in 

boostrap support for some clades. All of them recover a clade comprised of only specimens in this 

study with a high degree of confidence (100% bootstrap support, and less than 1% divergence 

among all sequences). We present the tree produced using the HKY+I model of sequence 

evolution as it was the best fitting model for the data (Figure 3.10).  

The phylogeny suggests that Seepicola viridiplumi sp. nov. is distantly related to the closest 

sequences in reference databases (Genbank, BOLD; with only 70-75% similarity), which is 

perhaps not surprising given the paucity of data from sabellids collected in similar habitats and 

depths. A clade comprised of Seepicola new genus, Eudistylia and Schizobranchia is recovered 

with low bootstrap support (65%) so is not informative about how the genus is related to other 

sabellid genera, except that it is distantly related to those in this study. These results provide strong 

evidence that the specimens collected in this study are unique (at least among the barcoded 

sabellids) and thus constitute a new genus. The phylogeny and distance calculations also show that 

the species here is not closely related to either Pseudopotamilla reniformis (27% sequence 

divergence) or Perkinsiana fonticula (30% divergence), despite the morphological similarities 

outlined above. 



 

70 

 

 

 

Figure 3.10. Maximum Likelihood (ML) tree showing the phylogenetic relationships between Seepicola viridiplumi 

sp. nov. and four other Sabellidae genera. Numbers refer to bootstrap support (%).  

 

The first phylogenetic approach of Sabellidae nested the genera Potamilla, Perkinsiana, 

Potaspina, Pseudopotamilla, Eudistylia, and Schizobranchia within the “Clade VII” based on 

morphology (Fitzhugh, 1989). This  “Clade VII” resulted monophyletic based on the occurrence of 



 

71 

 

 

dorsal pinnular appendages and elongate, broadly hooded chaetae in all abdominal fascicles. 

Potamilla, Potaspina and Perkinsiana formed a polygamy with the Clade Pseudopotamilla-

Eudistylia-Schizobranchia, which was defined by the presence of unpaired compound radiolar eyes 

and dorsal basal flanges of crown (Fitzhugh, 1989). 

Posteriorly, that group ( “Clade VII” sensu Fitzhugh, 1989) was recovered in a combined 

analysis using morphological and molecular data, called "clade IB” that includes many other 

genera, supported by the presence of companion chaetae in thorax and broadly hooded abdominal 

chaetae (Capa et al. 2011). 

More recently, using transcriptomes, Eudistylia and Pseudopotamilla were nested within 

the Tribe Amphiglenini, Subfamily Myxicolinae according to Tilic et al. (2020), which is 

equivalent to the “clades V, VI and VII" by Fitzhugh (1989) and “Clade IB” by Capa et al. (2011). 

Under this scenario, Seepicola new genus would belong to the Amphiglenini Tribe, Myxicolinae 

subfamily. 

 

3.3 Species Abundance Measures 

The density of the sabellids was variable within the seep systems. From the analysis of 

ROV images, sabellid density within the seep systems averaged 330 ± 233.3 (stdev) m-2 but ranged 

from 98 to 655 individuals m-2 within the authigenic carbonate. Sabellid density was most 

concentrated at vertical facies on authigenic carbonate outcrops and more dispersed on horizontal 

surfaces (Figure 3.1C). Occasionally, individuals were observed on deposits of shell hash. In situ 

observations and video footage showed that the sabellid aggregations at each of the collection sites 

were composed of specimens of varying sizes and likely belonged to younger (shorter sabellid 

tubes) and older (taller) individuals. Observed sabellid tubes ranged from approximately 4 mm to 



 

72 

 

 

104 mm and were intermingled within the aggregations. The aggregations at Bush Hill appeared to 

be more extensive than at Brine Pool NR1 and Green Canyon 234, although this could not be 

quantified. This difference likely corresponds to the abundance of exposed authigenic carbonate at 

Bush Hill. Epibiotic Seepicola viridiplumi sp. nov. also had varying densities on host Acesta 

oophaga file clams. While several A. oophaga bore only a single sabellid, one file clam 10 cm long 

and 8 cm across, collected from Bush Hill, had a total of 58 individual sabellids.  

 

4. DISCUSSION 

This study expands the number of sabellid species known from chemosynthetic habitats 

and identifies a species of high abundance at some of the best described hydrocarbon seeps 

(Cordes et al. 2009). Seepicola viridiplumi sp. nov. is the third to be identified from 

chemosynthetic habitats and helps to elucidate the diversity of sabellid polychaetes from these 

environments. Several species of sabellid polychaetes are known to form dense aggregations 

similar to Seepicola viridiplumi sp. nov. (Capa et al. 2019), and this may impact ecological aspects 

of the hydrocarbon seep habitat. Gregarious sabellid species such as Bispira riccardi have been 

found to significantly increase local meiofaunal diversity and abundance (Enrichetti et al. 2022). 

Suspension feeding organisms, such as sabellid polychaetes, also